Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /var/www/connec.dk/public_html/wp-content/themes/jupiter/framework/includes/minify/src/Minifier.php on line 227

Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /var/www/connec.dk/public_html/wp-content/plugins/simple-history/loggers/SimplePluginLogger.php on line 1078

Warning: Cannot modify header information - headers already sent by (output started at /var/www/connec.dk/public_html/wp-content/themes/jupiter/framework/includes/minify/src/Minifier.php:227) in /var/www/connec.dk/public_html/wp-content/plugins/download-monitor/includes/class-dlm-cookie-manager.php on line 56
%PDF-1.6 % 1 0 obj <>]/Pages 3 0 R/Type/Catalog>> endobj 2 0 obj <>stream application/pdf connec Nyhedsbrev nr. 8 november 2020 kopier 2020-11-16T15:22:40+01:00 2020-11-16T15:22:40+01:00 2020-11-16T15:22:40+01:00 Adobe Illustrator 25.0 (Macintosh) 256 72 JPEG /9j/4AAQSkZJRgABAgEA8ADwAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAA8AAAAAEA AQDwAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgASAEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9Gatr+sWmqGys9GkvYvR SVbsOyRl3lEXpkiNwCvIOd/s1PbMXLnnGVCN7c/j7nPwaXHPHxSyCJuq68rvmPd76Sefz55jjnSN fKd4VdORcmQgHgG4/u4ZRUn4RUj/ACuO9KDrcl/3cvt/U5key8JF+PD7O/zkPxyva1rfzn5kmV6e VrlZBAZY0d2TlJ9YEIiLNEoX4G9Sp7e2+Sjq8h/yZ5fpru+LCfZ2GP8Alo86+HDd/V37e9fb+c9Y e8u7Wfy3eRNbrctDIFkeOVoFDRqJPTCj1aNTfrQb1wx1c7IMJbX9nw6sZ9nYxGMhlgb4b5WL57X/ AA7fgLbnzpr0PP0/LdzchApBh9YV5QmSoEsERoH+Dpy61UfCGEtXMfwE/P8AUmHZ2I88sY++u+uk j037vPnUIOkXOpeYDLc6T5jshczC4eU6jfLBC8nxMEEMMhVAW4gKfCvEVox1szIXjrzN/wDEs59l 4owJGcHyFb/OY/HK9r6frWp2/l3y7JeM0ZisY0VTd3MdsjUIQc7iYhFJ8W6nMzJIgEgWe51OGEZS AkeGPfV18GKXX5pXdmkrXmnafbCGiv6utWKBZCA3puWoFb0zz+WYvj5v9T/2Qdj+U0v+r/7CTm/N q3hur63vItMtXsomlIfW7AN1URh1LAxhy6/E3iPHJDNl/wBT/wBkGEtLpgBWb3+iWyN0zz7qupq6 WOk2t1dxSSRzW1vqtpMyekoJ5FK0PNgpHUYPGzV/d/7IJOl0114239SS+Xztra7ppFpIvFGoNVtg 1WFWWhWlUOx3p4VywnU/6kfn+xrji0Z55+/+A/r6pT5uu5NdhSGa0lVYWdV+o63Dackd2Vmbiy8v gjRgG/mI8ayJ1A/yRPxDGGLSnnnEf82XPb9N/LzTn8vNJeytLmYx3kSTemkQvNR/SSlYg1TGVZlj ozspp1oMljlM7SjwU058eOJ9E/EvrRH3onW/OkWma5b6SEtHkuFJQS39vbyllAZlWCQ824oeRp2y GTJkEqjGx32zxYcUoXKfDLu4SftSxvzPtuCtGmnSGQKYQNXsvj5xqy0Nf2pJY0H+up7jK/Gy/wAz /ZBtGn0/+q/7A9/6t/sUh+a9kzShRprmG2N3ME1iyYrD6SSLIQDXgxkpy6dD0Ix8bL/M/wBkE/lt P/qv+wPef0b/ABV4PzMtZjcIi6e00E0sAiXVrNiTFRd6H4WLuileqlhXD4uX+Z/sgg6fBY/e9P5p /Gyy1/NC3vL0WdnFp9xOPTdkj1exZvQkHL11RHZilGQrUCoYYPGy/wAz/ZBP5bT1/e9P5kvkxFbT R7y8M0WsX316aYWNYfM8bSLL8LvbqVZm5Jyc8Ovw175IZsl34Yv3hicGGuHxjw/1Zef7Pn5PWtY1 SDS9Pe8meJFVkRfWlSBC0jhFXnIQvJmaijudsvmSBsLLiY4gmiaDCU/NlpJDHFZ6dO37riItbsHN biMyRAjkD8Q6eIqRUDfF8fN/qf8Asg7H8ppf9W/2Emrj82v9EhvbWDS5bTh6t3KdasAkamWSJB6g fh8RjB5VIrVeoJDLNm2qH+yCw0ulN8Wb3eiXlv8AePtRkX5nW8unvqCRWH1MRs0Fx+lrH05XSQh1 WQMUokSvIxJ24kUyQzZd/R/sg1nTaex+96/zZbbfr2+1By/m9DbxPJd2+m21DwUSa3YAeoOY4Ma0 WrRSKK90YbEUyPj5v9T/ANkGZ0ulv++/2Ekr1/zjDrypZyXQ0+/jMqwafpuv2MUlyA3pyFwRyKx+ nJ+zsQQR4EZ8tG8f+yCPyun4hWbbv4JbMi/LSS1P6TitdTuNTt4WhSGWfUbfUVEZVmiZPQP7sSRF XoyioI60rl2OcjYMeEDk4ubHCIBjPjJ57HY/FW8w/mPpuj6jcWJl055Lb00lE+qWlq6yzRSSRxvH K3JWbgvGvUGvQHIZMmQH0xse8NmHDhkLnk4T3cJPd+35IHTPzUivPQllh02GykmMM12ms2MyR8UE rH4D8REXJ+I34ivTIRzZSRcK/wA4N2XTaYAmObiNbeiQvybi/M+eZlWGxsJfU+GLhrFk3OQxCZY1 oTVmjPMf5PxdMHj5v9T/ANkE/ldL/q3+wkvuPzQgiubq29PTvrFlbtcXML6xZK6cKVDLUsq0blzc KONK0J45I5sv8z/ZBgNPp+uXr/MPLv8Ax18t3P8AmZNCLUXlnYWcty89Un1ezTjFbxpI0gru4AZu XEfCBU7HAM2X+Z/sgylptMCazXt/MO/Pb7vmwiOSAXDXk+u3sJhCJcSt5msPgSSYRFGYRg/3gkWh P2kp1xGbLd+EL94WWn09UM5I7uCXn+Pi9Vj1y9YbpH9zf81ZluupV/S10wIKpvttyH8cVp55qk9j pl6JrWe9nVHYIp1nVpwZYzV+aG94cUKlWUqafSQFUaJ7LUdPjupHvhJfRwXEgh1PVYFDensEVLpD GKNuq0qd2qcC0mel+YL6xtY7K1QSRR14tcy3N1L8RLHlNcSySt1/abbp0wrSLm85X0Qo6wc/Di3/ ADVitITzzq31j8tLq9uLyfTnnaKNbqwnuLWZXN0saCOW2gv5lLtRfhhatadMUPPU8z2Esiyxeapp mnuIYYv9z16IrponR4CeOl8IxOsE6SC3ARmDJ8TfYVVrL8yvI08yxSXw9O4igMITX/MTySIbWVD6 CSW0fqNzUx0jPJn3akwVcVZ5+WHnXSvNdvPdaa8MiwAR3Jhu7+5CS8jRON7b2pHwUPKle1KCuKvP vMel6hb2dnBY1ivdQmWK1kCepv8AExopDKf7s8gSKLVqilc2Ou15xx9H1W4vZPZ0Msz4u0ALYzZ3 fmrRdTGmeZoI7hpRKbeaFKO5jVmoOHwklUJ4027t0rhY+1cvUW7HUdjYKuJr8efX7H0B+X7c/KOn tQColNAHFP3z9nVG+9cGTKZniPVxoYhAcI6MB/OHUbLSdZjZtLhv5NRgEdw8r6ZCEjYSQiUm8srp pPR5EBSxH71qqRmPPJwmm2MCXmtt5l0W3k/R8WnetbCNpbiGBdBaCOa5QwIGEOiL+8eKSor9obfE tawOegNubZHASSO5mUGsaaLeTXotEiVrji82qwnSWkeN3V0h9T9H1eMoEQd+NN+XxZPHk4o3TXkh wyq2H+YPzD0fy7PHqcWm3Et2QI/TRNDiEkfNTN6ko0gyqJZX5uFO7MSOOTBtgz3yZFH5v0HSvNNt o95Dfy2ksZnhi0CR68miRWnuLOFqqymQiNFUMd1YGmUyzSBIESa936XLx6aBiDKcY30Il+gFPIBp PlK0u7+LylJ6ccpeOQQaZGsLAIjBXskUgFooixbkeVRX4AMoy6yUASYH7P0fjn3OZp+zIZZiIyxs +Uv0gef2d7LfP87QeUdRkWx/STBAPqP1BtU9UMwBT6mkkBlqDT7YA6nauZ7qHlcH1+S2srJvKtmL O5hqbR/Jc6pAszhgsi/pD0x++VS6qSRQORxBdVV99rxtY3vdP8mTW9+JhcRRf4PlmmK3UMTSgmK7 jTmZH/eMZVNU48WpUqo3RPO66eslzpXk/UdMeRSZooPKk8EzQ28SxxWzPFc8DIW+KM14BBwIU0OK ot/zG8/QaU93Np1/LNI8aQxR+WbrnHyt/rB5wLqUjPWoh+2oWTqaDFVWT8wvPs7H6npl7FBy4ieb y7cOR8btQxjU45NoOD140qCu0hEQVZd5L8wa5qzX36Us7i3RXD2Tz2DafygevDZ7m7Zm235CNh+0 i1FVWLeaTPZ+dJdRR/OlzFwaKe00xYm0qKNI4yzLG6q7sfV5Boizlgyj7PHFWLabqavYJDPF+Z4h hm4+pdQgTsbh1BBaBfWZFUSb/sCtCHEVFVc2wVZGnT8yYZZrmGKc/WFbmzIJPTX0ZHjjjkdFDSR8 OLPwDqnJVVR1npnrLcyvqP5gVmi+rq05RCBcFxWONYxwasqyc+AMfwpVQrxhVDaJqWn2FtHHcWP5 j6qJniW3S++tRSRvHxYhngktCFJu25tKxRvTIBoiYqm8Pmjyy87XM2hedLW409nkuYHbWCkdJWIL rDcyQTKxPwheY4U/YU8VWWRUpgZPCfzv82603mSTRILqSDT7eNY5YInZFlMsaSkyhactmpQ1G23U 4oYDZeadY0+xexhaOS1Z/WVJo1k9OWgX1ELDrw+Eg1UgkEHAr0nyj55l8y2IstSlkW9gZpLuS1LQ s8CBFV3ZN15SSVPpkfZ3opphVMfy28x39zeanZXl19cgsJIxa3LFXdo5edObp8LGij3BrXwCrJr2 TlK+9SThVkd5Yatf/lc9npbTx38gPpyWt7+jplC3JZmW69Of06KDX4DXptWuAlassd0nyh5n1T9K X/6Q1m0eEz21jHNr6tBL+9+srcL6FtcqnCRjD8XL4F4slKrgEgRYLKUJRNEUW5Pyv8yGNZo9d1WG k8noqPNF60c8DEPAru9kzISwEdIqEIT8bnq2EcJuqZX+Xnl7zDpEMn6X1C41AyIsavcal+kgvoni oVvqdh8R35sVLE9SdqEG0EEc2D6Z5O8xaTcJfavfTaoFXhaRTFiLctHKFaQkmRV4c0+IUq3jmPlg aslv0s+E13/2pTYadFe+Zzawc7uaC2ks7fg4dBJIrmaUs5f06xylAPiISlegyWPCZC2/UZq2D2vy xavaaDZ2jLxNuhiCnqFjYqo+gDLYihTgyNm3iH/ORNlfyfmD5Mu7SbjEJ7WxvIYyWkKXV2JEZokr +7H1ZvtgAkClaHjHIdjt0ZQjZ5sZuPy/1y70nVp9ai1K4ul0e7vb03MZjhivrO1tprGGCaM1mVBM 6PJzPqSQ8m2oMrjvIe/7G7JO7J5/p6IrRb1LTyjFo2r3kMDPZQyIrBSOPD9yBCjRSjgiIHUP8RX4 SN6255njIA+ER+OfNpxQHCN79/46MMMmsanPq+m/pFH8tWc5aC2v7RZI0jvAbcTyEsKyQBk9N2bn Sh6c1wkGQAH7V2Fn8f2Pbvy1srTQ/wAvbDTT5jFpLFEyR2lxJaQBuc8nJpILmOZlpzPKjfFSnhmD mNGXqo91x/SP7Xa6WBlGNYzMb+rhn8riR+xGebNftV0S8EHmTlfXBaGRIjaTeqEFV+O1gSTiyHjz LCh240rTD1GYcBqfqP8AV3+Q/HKna6DSyOWN4vSN9+MV8JSI59K5b2y380n0pPJF+dW06DVdOLQp c2VzdxWEbI8yIW+sTvFGrJy5KC4qwABBoc3jyTyWHW/K+nadd2D/AJe+XY/qnCaTTNQ8waXN6XMS Su1JfXEIE03pxUoD6g+wNgqmOneYvI09nJeReRPKq304uY7SCLUdEcysOMYgklQUWS49YCi81AYc mqwBVWXnm/ync2zyJ5L8pXT3KXSSF9Z0oI6wcbmRFkELVLyO0orQAUdyjNxCrd15w8ri2ZT5K8oz WTG3iWZtY0lLZ0dYlehaHdUeDim3xiBvslFUqrIPO/ldLWGHUvInlnTJrWWa3t7ObWNF9NLaYvHd PEKLuZI2jZOA5H9qnKir0j8vdV0nUFu2s9J03SbpGMd9Dp9zaXJ9ZJHMiu1qBWjyM3xUPxVIBJGK vP8A8xfJ1zqXnPWJ20rTr6C9gjt7aS9sfMVxS4RYwokNrys1QLM4WeLiyFm7rJVVI73yR5quoWis dE0OW4Qs15zsPM1nIsklx9aAt70tymQXFZKoyjYbb0wKpWX5e6lWztb7y1ptxNIi0tIx5thsPq9u qtbLNzhnh5qyyFo5KVJqas26rIbH8l/MDXr6m2keWLe4e3hSCSE6wko5WqxTID60LW4BRViKLyVa 7AlqlVt3+Snmv9IxXEGm+XbhbJRLZyXN5r3N7pZpJYnlH1iRaRmdiS3MtuPhDfAqttfyY83xX1nJ Do3lrTQiytdz219rjo0shDllt0ktFo8gFVZm+EKtaIoxV6LFMAMDJ8vfmFeS3fn7WHlcuVupYwxp ssZ9NB9CqBgQxuU03xQu02+urC7S8tGCXEfLgxVXA5KVPwuGXofDFWdflp5knS+bTpJ6/WZS626x IOZ9Ni7mQcaU4gkH6MKXpU0x3NflhV6Z5OaRvJluyGshSfiTy6+q9PsfF92+RlyNMoVxC2MT6Fet qEMa2sVpI9WaeO0+sAHlyV/UfSt2Xj9lpQTQfFXc6k4TdVX+bf8A07/T8Xo46qPATZl5cXD8KGb7 o7b7Jinl/wAqXEFpapFeBVDvDIdLBT94WL1E1m8aVIrSg7cdjlowYiAPV/pP+OuMdXqImUiY+f7z u92Sz+LZPoFtZQ2VbNZEhegKy24tGLIoTkYxFAakKP2aeG2ZuCIA2+6v0B1eqnKUvVV+UuLz58Uv v97H7axm1bTrhL+2uY2vSYpEkjZHipVlkQsDutFKN+y3TLiHGtBeW4brSpn0u50d/r8vxDWbe2cQ 3UbD7crAEwykL8aN+102IwAUKCZSMubO7ckwqSpU71BFD1woeM/m/ceZ08yRW1je3ttp18YLbla+ Y7DRwkxoRSO4tpZwWr/utyWAPw+KrH72XzCkNjq7alqj2we3nMZ842MYkAUzzCNRCltPGUZnflKv 2CE4RhahVLUtS1cW4C6vqVvZxTeiUk856bCIpWX40mufRlufURH5mMyNRlenwrGXKoa81TzLDfXl 9Nqt7JA8h06aV/O2n21rb3MiMshiCW8VTBGFNHQMGJIRz8eBUZd6vqdvLEGu9Sge0nnijsrjzhYx xehNbQl2upmIuKwif1Pg9Qo1eLcShxVEW/mibUrgW1vqV7FHBNbOqwecNLmR4GKWzeq5Mk4bhP8A Gm4LoCj825MVewfmHe21l5VuLm6bTltUltvrDawjPZiM3EYcuFDfHx/u9qc+OKvB2892tkqQpD+X qQWt1FM2mx6fqCSJJFAZZ5ypgDQyIqUX90zKTwJLrRgqe6h5s0bUNM1JUsPJ17c2DSzaqb2xv0gg mjDxJJwNpK1xwSFkMi8a8aClaKVRhuU1eO0ks/LmgappF41zJNf/AOHdUlT9yxnjkjVbcrLVZpVD chzdyyVPJCqmVhZ+atPuRNbaV5ejv5bq4kSaHy9rEPq0WMyGSUI31VnkiP7w8w/wsoJ2KqPsvN35 r27u+qwaRPbLGWeW2sNdhdDAwW5+Fraf1KVJioVMgFQKGqqsv8jah5tvdLabzMtmLtijwNYwXtqv pvGrFXhvlWVWV+Q+VKhTtirDvPup3ceu3Yh8h3euI0RhlvUnuolloqelGiRRSr8UjUL1AVVJJ7ZV PR4pm5cz+O9ycfaWfEBGB2BvkOfyY9a69qgmmurf8ptRhe7bmjT3dyrO4ZplLqsMvpfCg6/tkJ0+ LIjs7CDf6/1spdsaqQAJ2HLYfq7lKbzG7fUreX8qNYZbyOOWfjJfH03jhHpKX9ECvI+mebLSnJtq HE9m4e77T+tI7b1QIN9/Qdd+5VTzB5i1LVFtYvyjvWmji9dZbi/ntYvUJpLGsssKQ1V3enJxyA5L sVqT2fg5n9P62Me19SNgfu/Ui/N/mbRdDfStH1TyexvLuyhujZHUj+6lKyQPB6q8lf044/tlgD23 yqWjw8qv5/rcvT67Un18XD3mh7+7vYH5m/Pzy3pmtxWlx5D9aSdRL6o1eQCs4Fu4KxxOtQi06/1M hocR5j7T+thLtHPDYTse4dDfUfF7T5w86/ofXWt5NVWwtoVtzKJJNJRAZmIAP1u7gnFVVm3jpRW4 1O2HJjyGViVDuoOPiy4oxqUOKXfxEfYlL+fL2GygubzXhYxCZFlluG0JQ7evIklvyF+yB41X46NW i7VbkBDwsv8AP/2IbvzGn3/ddP5528/x3tWPnrVb2q2urPcSxejJNFG2guwRzLKoPC/YD1o1QKen xKa/b4vhZf5/+xCnUaf/AFL/AGZ7vwVsfn+9CRypq7X09kRaahaxS6CsgnuG/dtIP0isaMr/ALng WqWB4g9cfBy7ev7AstTg3rFVnb1HbyVtP/MiC9hN0vmGKG3iDPeO8+hyLbgyKI0laG+kC81DcDUj xINBh8LL/P8A9iGHj4P9T/2RQ9v54168b0rbWv8ASQ00M0KjQpHV45UVjxTUmp6YuFqCSQF+LdlD R8HN/qn+xDaNTpf9R/2Z/UzP8wNQubPydd3lpq40WYejw1QCzYRh5UBoL6WG2+IGnxP3+GrUGZjr Xm1z5s862E8t0fN76jYSWn163EFt5ejiURoBIQ8uopJJCDIHI604j1a15KtDzrrtxqlzYw+eWtbq K+KW6TL5adCjcR6TxJe+u6CSMotOElZApqVJCrenedvNUt8t5L55tLnTmhadrW3g0JF5wwsZLdJT qkzB15rJIWqo2+IAnFXXXnrzRHaG7bzjFb29o31O4jeHQPWlnZgzKJG1RII7iGPZgw48gzBGXiMV Q+leYfzDvvMtvp9153ksLVmkS5V4PLfrQ8llntxIY726cyNHHT4benEVp9psVeoeSrq5uvrs0vmq 18zRsYDGLOKCNLYNCrU/cvKSJf7xeZ6Hao3xVgv5kecNA0Pzmlvef4cs7u59IxX2q2F5cTlvRljU vNDCIh6TSp1m2jZq8aglVgI89+WY7vUYtOg8hQxW8gksEj0fUpZTJAkkiXD+lbIGCqjHnECED15H YOFRmmfmT5a03WwNMPk7TIlnME0FromqLqDzGWWOONY1hhYf6O3Fmo3FyVoQwGKspm/OjWtOezS+ 1fQLqW8jnaKG3tdWTkqGVorkMiXLCFkjUH4D+0wdlWhKoGx/OrzjqmpSQWmseV4IQUVYRaa7czo7 SemySVitAr/BI4UgNxWpHCrhVGRfnF5nn8xW9jBq/luSwajXEsdtrErKs0zi1X1FQQK08XAJzYVY 1XkCgZV7XiqR3/mWysriS0T0nuoyWMA9YkVo3JvShk4151rlUsoBr8fc0TzgGuvx/Uv0/wAxLfTC KEQ8/h5KzzIahuMgX1IU5cPbvsaYxy3+P2Jhl4uX6f1JtOxWCRlNGVSQfcDLW55l5p8xedZL14NG 1RLGK1hDXD+jDKxeUniKOrD4VT265XKdN+LFxIDyd5m/MRdVprmqx6hYTVijAhhhZHoXV/giWv2e NK98YztcmHher6fK81nHI55OwNT07kdssaHhfn/zP5qtfPesadbfo79F1iZ5rjzNNpzxoIoiC1um oI8A9RmU8IV51X3JuiBX7HHnI3X6WNXHmzz6lwLH63o0UMK8Lu4bzReOplCguSw1ZHiTnGkbcxyD N+1yNZUPwGPEfL5/tRcHnb8wr63kSX9Gwme5hiRk1+beJm4vN+71pWhUIYeIVzyZ9q+oDg4R+P7E iUj/AG/tbl84ecpYLK3tns5frls6rw8wTNMZLeRSzLINdQMrBm2SUsKfESBQPCPx/YvEfwf2pB+a 3mR080+S4bq3Ly3uhWb+rHdNeJHcXM1xGvG5aSYzBgWBLSNtQgmmViPqtz8easVfFjHn7yXDcwJq ltfPdy2SQvGqRgwJb8llkBlQspdzMJE3rx8RuJQjHcg215pz2jMVVj8fN71+Yfn/AMq6R5vvNK1C zsrm6mg/0tZdMt7mR7eKOOQLJJJe25ZCs0iqWTivxM1EjdmqYsJ0j8xfKX6Oub7RNK0lpLKFL25N p5UVOFY5TuRqiKGiiSbkxenxcVJJ4kKym8/5yCszJaWVhM1nNcvbJavc6PLJFNHcO8UbQ8b+BaHi rir/AGK9WBVSqZ6V+dYvrmOyVpUukujYsv6GnYXMkZaF3t/TvZKRevxHIk8fsvQspxVXb8yPOVnZ z3t1p99fRQzpGYLXy5dxTsjwCYsqvqElAPVSrScOPFlI5UxVE2v5iea7nXpLFdI1KNGllt7aGbQZ oQzxRtJ6312S/W2MT+mVUHixJHbfFWRfmVb2915Mu4Lu6sbG3kaAT3Oq/VxaovrISX+tRXUBb+QM hq1BUfaCrxi30nzHp0MCp5t8mWAl09Xllg/RsMUSPOPSuIIzYHnFUtUSSBXeQ8eGxwKjb6LWkhvb xvOPky01S6jj+oX8j6e728UgaZYBKbNBNC9FKVStHZvi4ryKoaz8hw3Wr3wk8x+TLPR7BFW4uILP SL28hkhYc3dWtLSKBpEjYsXL8GrQUpxVTe28peWLKO6nHnbyjHZyAyemNG0mOHiwKj1aTAyJ6V6q 7MtQyb/EwdVSfyloVtpk2kt5/wDKsSyiaae1/QulKjeiiKZfq6zCrwyWsjMTyWvIFaKAFWb/AJS+ TLPy5+lHs9e0/W4rr0I3/R9hYWPpS2weOT1Gsh+8rJy4q/2KEbkscVRvm3y7pN5rcOo3nnPU9ENs 0Tfo621GK0tWPUCSMryYSCPoW7HjT4srllhHmQPi3Y9Nkn9MZS9wJRcNj5J5XITWZZfW/fXCNrN5 IoWFi7cUa5KxoOJ5hQFps222AZ8Z/iHzZHSZhzhL5FDafYeQbe7ae18xTyuY/TMcuvXlygBcUYLN cyUblQV/rg/MY/50fmGR0Occ4T/0pXrY+QYbSRTr9wILoKpkfX79j+7O3pyNdlkNR8XAiveuP5jH /Oj8wo0WcmuCf+lK9dJ8jXNtBaprNxKlTHAy65fmUu5WSglF16jP0oeVQpoPhJBIz4zykPmxlpMo 5wlt5FdFpXkiNoFTWLgvG8Zj5a3fOzMjsUVy10TIOUpHFqg7Ag0FHx8f84fNfymX+ZL5Fk93d2tn ay3d3MlvawI0k9xKwSNEUVZndiAqgbknLXHYjN5h8q3l0kv+K7VLHU2pZejqkC+o0fAFYFCgmpBD BZD952qMCTz297ScZJO5r3/s/SjrPzN5UYRCDzXbTx3fJLIfW7R+fogiT02oWkI4nluaZIR82YiR 1KZW2vaHqtpcNpeoW1+scdXNtMkwAdA614FvtIwYexB75Nm8Qh1CPVPM3mezjne2lgvbN2ZWoXiV BEy8a1K8o96U+19GUSc7ANmtY1D9Halp5juGZdS1KytraGoKcA9Zm4t1BXqw70wxTn5PddDNdKtz 7H/iRy5wHz/+Yuu+XovzQ1S2me2S7tqyN6mg6TcSc0tYpVb63c3cM7lOQ4koBSo6LzF8QacaRHF+ xK7fyzrttqySGHVfTt4EWOX/AAZpksMscEdVf1IZWqOcC0X+8pxAP7QNj8FHCb/YidQ8t6/eTxQ/ oq6S19KCIS/4M0zgIV6ryluY5kUs26ceS0FN6kgEfgpMSf7HahbeYWS1N7peranbwySFrZvJWmzt Vq+n6rJP6bBUY0MNB/NvtiK/BU313+CH/NPyz5vur/Rfqeh3msaPF5YtoZ0+oXFt+/Bul9FbS0hn it5SJUbgEHp8VBdVryrvdyYmovKb/wAr/mxqtzGbryVqkcxkjaa+TTLyOWURlYwJeKBCOK1+z/Gs xIEsQKfV3nLyn5t1nzaLnTv0hDZW0ak8PMM+l2dxyUAL9Xtre7kDRsGJPwV2+JvsrSyUrLyJ52t0 v1kvbm4e9Ccnl8xXjMKwESLHSwUQAz9GiA2NQBxVMVS27/LL8wmtZLe013UgslxcEOfM1wHFs/p+ kgZ9LnYFfT8arv8AG3NsVTjyp5C82adf2tzf394VtGSqvr9zqImU/wB8ZVnsIPtFUbirAVG3AF+a qtrfna1T8wYbK2k1KaLQ5LK01uG3SAWcc2tv6Fn6xkmgmc8pFY8I5VUU+yeWVywSMhLioC9u9uhq 4RxyxmAMpV6usd/xyrztv8ufOC6nq93azvqSPrFsnmDRrbUYoQv6PuH41hlgnuxROcYMblCKghN2 xx4JQMiZcQJ+TLPq4ZRARhwGMdz/ADvP8b7sk876XqOq+WbzT9OubmzvLngkN3ZNxmhYuKSg+tbV CfaZfU+JQVoa0NjjvLtA/Lnz/NLDp195g8zWumh5bue8v7mAyuTxEUAls9TlmQIq7/CytyY/C3Eh VML78m/zAurcWyfmbfwwLDDEWSGX1iYI14uZfrexMqtISAGbkVZiAvFVE/8AKpfPpt5Um/MjUFmm t3jnuYomjJmJKxSqjXDxxKkfwlYVRmPxF60oqiI/yy8/RrI//KwbprmRFX4rd2gDC6ecn0XuWbeO QQjjIp4ipJPHiqgx+THnCGzmtoPzF1WVJDGVkvWuZnjCvzlCvDd2zUk4IvWqjlx+2cVZb5E8lan5 Za9N75jv9fFysKxrfSSSeiYQwLL6kkvxSKyl6UHIVAANAqx7zT5Z846j5n1GeOW4k0krGLa1XTdD nTa3kHJJruf12ZZSOPqIFBJFGUkrXLFCXMA/Bux6nJD6ZSj7iQoaD5R84XUdxHPK+kXBRuV1e6To jB2lIrDGtlc3B9CnMOktXYPtJXfAMGMfwj5BkdXmPOcvmUfB+XPm+3tI+Hmqzlv2YC9uZtDsvTuF Bc8WjiaFgasn+7P2B4mr4EP5o+SDqspr1S25blQu/wAqPNFzpjWw80WdvcpLI9vLDoOnmFY5HDBH hl9UngOSqyOnWrcj1H5fH/Nj8gzGtz3fHO/6xW2v5X+d4oI4ZfNemyxrUTsPLtmjTUYFRJSXh8Kj 0/hQfCT+1Rg/l8f82PyCDrM13xy/0xTPQ/y+1vTLq19fVdNv7KJ2aeOXRbeGeQ+ozoVlt5IY0ZE4 CvpHda03oEafGP4Y/ILLWZjznL/TFk3mr61/h6+Nq9ylwsfKI2Kq9yWUg8YldkQs1KfEwHiaZc4z xC20jzbc2+n2r6n54kgsmAnv47aezF0AGYq0c1+LxTJIyKzsKDieHpoWbFUMtl5/sHSws9V832sc FxIyTXWmT34IW2ZSRJFqMoMYQoyxsvxTn4QByRAr0D8urTVNNs9cOoXWuzpHHzX9PK/MD6rEzcJG uLhH+Ply40XlyC7LUp5JAsvnbT/M9zH+ZEt7A70uZ2V+IoHjmBTgynqOaq3zGUdHNx/Us8xeZZrb zXb6hdyGeDSLkehbKeKBY3DEJQUBcj4iRXp4YYlGfcm31t+Xeu22veTNM1e1R0gukdkSTjzHGVkN eJYdV8cuDhkPPPOvm78xrbzxf6TpWneYpbFUD2VzYpZCzZxCJPT9SfS7gryKsK+s+/0qt0QKceUp cVC/x8ELa/mz+ZFhqU6P5K1/UYHd4l+uI6xQ+iSBJGbPSRIyzCm7M29eg3LwDvXxJA8j+PgzHTPP v5g3gguH8gzw2EvF2c6jaC4ETK7V+ryekQ6gRqUdlozbmi8siYjvZiR7mRReYdYeFXfyzqMTsaCF pNPLAcqVYrdsg2+LZjt77ZGvNnfklmtaR5sv75L6wkuLSOSJVkspNRW2COhLA8IrO+XqqgkS0ZWP IfCBkDjiTvfzP62yOaQFCvlH9R/YyPRtL/RenRWf1u5vmiFGu72T1Z5D/M7UVa/6qge2MYiPL7yf vWeQzNmvgAPuADyj8yPJGq6h5vl1GLT7C7sna3A9ddfeVZmiMH1gJYyfVucJKFWVA1K1eMryyTBi K+Wb67vHYeW9Pskulkurl103zf6kdwJUnDLxitkc8LWGoDoxkqRWvFgqbaL+U/mhriLzFb6BoDz3 ccazW9/da8LgoJC8ZZrv4o3i9OAnlCSSrEcdqlWT+T/yku/Lepm7s9N0W0U3kDFrSXU1ZrOBOKhl kmdPWQuxqQVkpVgGNVVRGv8A5f6u/mHzFf6JqUUWq6/caXqKQ3llczWgOiCN7WJrmF41j9S4hPqn 4jwI4rXcvi7iP6D9/JPgekz8x1F/Lmm/lHyeNK1exluCxm0TSn0PTpUMhjks0uFeMzB4EX1hBHb8 nSXizmUBAEx8S9vx+N18GgD+kfdz6fiwivzUXR28h6r+mLGHUrLgoNlcXcWnxSOzhYw11M0ccdHY EMT1pTemKHl/l/yfoEqalp0H5dxSJHEts36O8ym8cxsrXDQ8pJYJYFLFAy7Bi4J+GpxVFQflwtto 93YJ+VqAwrIbeJNfd4plaIoY0nkImTkt1MFQx8A3JqgtyxVT0b8sXGs213P+WZsXjBvFu/8AE1zc cbiZkWVXUnkZPTB5dUenEmhqFVFvy2a6W5jvfyoaWNlKFW8xFo6QmaSBbaPmgjjBVUU0jKiQjjx5 VVTnRPLN3a6rcyR/lLaWqOgIvrrUrWZma29P6tGkarcemlYYj8Oy8SaE9VWe+R7O4tYL1JvLFr5Z T1gkEdrNDMbiKIelFJIYkTi3pxrRSWotBXqAq8x/MzQW1DznqAOk29zbCD7aWPmczyS3CRq/qz6Y v1aWLhCnQn7PD4TUhVB33lW5bS7SK48u2ciRrK0arB5oaOGG8QxhRaQ237wxJK8YjYoVUCnp8uKK oTXvy7u7lrTWNO8vaZLqtkIZ2mvIPNAZEjUBNlVXupVeIksyh+IUFGqtQqrqnkDVriQWNnoukfUL yaW5mlmsvM8UhN4Sz8hEyr6npxurO8i1DCPjGrUZVDeYvK01zo8Wm2+gWccfprIdOXTPN8VmpkcS +mfqccayUVlPJlBV0PwAuRGqyLyf+VWs2/mODzdN5c8tSvcsJijHVoLmLm5PqBbxJEWZAqNU2sbM xbdOrFXsuo6faajYz2N2he2uEMcqqzI1D/K6FXU+BUgjtirHLf8AKryDbPC8GlLEbeUTwhZpwqyL b/VVIX1ONBD8NKU79cVQk35L/llOoS50RLmNGVoo55riZIuDcwsKySMsSGgBRAFKgKQVAGKp1c+W tKsdC1K20PS7a1muLWSJIbaKK39RhD6UallCj7Kqor0AHYYCNkxNF8r3f5B/nCJ7qa10YrMkpe1k W6sxyXkCtf3w6cagH/arES3HIOhXS/8AOP8A+avpRxHQzNwX4m+t2QJ2oOs3agwCJZGcafSv5T6H q2hfl/pOlatbi11C2E3r24ZHCl7iR1+KMsn2WHQ5aOTjyO7BvPfmHSdM86XqXvk3RLiK5VI5tZv9 R0e2nuowIkmURXMbSN6auKiV1BC/6uS4iw4R3InTb6PUba71LRfIenay7sI5LrSr3RbiKSWOCNuM k7JEfhaUoKrXivKgqoLxFPCEVpPl83OtQafqX5XWunaRbtJ9W1WNtHmWJxKSjrAqJKiOqhyy/EG2 4n7WPEUcA7nomm6JYaXai00yNLG1DM4t7aKGGMM5qx4JGq1J3OAlIFJXqvnTyppV4LG+16OO9L+k 1qhSWVG4B/3qRo7Rji6/E4Aqyjqy1UrE89eU2fiNaJaoBHpnqabH9174qmV5Y61Lferb3dpHafDW GW1lkl2Vg371bmJd2KEfu9gCN61VVDnS/M3w0v7AUdi3+gzmqGRSoH+mbERclJ3q1GoAOJVXWeme YUL/AFy+sZgUjEfo2c8NHA/eM3K7lqGP2Rtx7lsVQ/6I84+kw/SmmerT4W/RtzxB+Dqv1+p6P+13 H8p5Kq0Wl+ZBPG01/YPAK+rGllOjt8KgcXN4wX4gx+ydiB2qyqPurGduH1SSKEivP1Y3lr4U4yRU xVfqUOoTWLxWM8MF21OE1xC88Q3FaxJLAxqOn7wYqlUeleahOrSajpzQCRy8a2FwrmIj92oc3zAM p+03GjfyriqidH86/Www1bShZ86mE6ZdGT0+X2fU/SPHlx25cOu9O2Kq1/pXmp5GNhqOnW8RRQqz 2FxOwcH4iWS+gBBHQU28Tiqh+h/O/EgavpXLkpUnS7qnEA8wR+kepPGh7b7Guyqc2djcIsn12SKZ i1YjDG8IVOI2YNLNyPKpqKbbU2qVVum2mqQS3BvLi3nicr9WSCCSFkAHxCRnmnD1bpRVoPHriqC1 TTfNc88r6fqWn28TMnorc2E9wyqFIcOyXtuGJahBCrQbUPXFVOXSfNptAsWpaal2HJaZ9PuHjKb8 QIxfIwYbVPPfwFdlV1rpXmlbKZLrUdOlvWr9XnisLiOJNtucTX0jPQ+Ei4qh30fzuVHDV9KV+JBJ 0u6ILciQafpEbceIpXrU96BVXsNJ81p/x0NS064+NCPQ0+4g+AN+8X476f4mXZW7Heh6YqjtS0+/ kiUaZPb2soI5NcwSXCkVFQFSe3I+GvfrQ9qFVE38V7LbGO0lihnLJV5ommTgGBccEkhNWWoU8tjv Q9CqkdnpHnRJAbzVdLmjrusOm3MLUof2m1CbvQ9P11CqnFo3nwSxmbWdIeIMPVRNKukZlruFY6kw U07lTiqMudL8yM7m1v7CJCtI1lsp5CG4vuSt5HUcihpQbAivxAqqgv0L5+qv+5rR+IpzH6Ju6nxo f0nt92Kp5Z2NwiyfXZIpmLViMMbwhU4jZg0s3I8qmopttTapVa0u11O3Ewvri3uORUw/V4Hg4gKA wbnNccqtUilKDbfriqWato3mi4vjc6ff6ZbgFliN1p09zKsbKlU9RL626uhJooBHEU+GpVU5NH87 FUEeraUjD+8LaZdMG+BR8IGorx+MOep2IHarKoiPSvM4iuxJqGntK5P1B1sZ1WJfioJlN6xlP2d1 KdD47KrLnSfNrIotdT02KQF+Rl0+4kUgtWOgW+jIKrs2/wAR3+Hpirk0HWmnikubnTZuJUykWEyu 1BGG4M14/EkCWlQacl68TzVVdW0O/k9JtFlsbJ+fK6a7s5Lv1BQBePp3FpxIA6nl2xV//9k= uuid:69c962f7-f874-9b4c-859b-3dfdb204fdde xmp.did:262805a1-e480-4130-b09e-b14286422fbc uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf 1 uuid:d260638a-263f-4261-8376-da8c2d72d5c8 xmp.did:a4ecb019-e50f-cf4c-99cb-c84dc71bba4e uuid:5D20892493BFDB11914A8590D31508C8 default saved xmp.iid:ff5008bb-2f12-4a7b-bc23-1d013a3dcd6e 2019-09-08T14:01:18+02:00 Adobe Illustrator CC 23.0 (Macintosh) / saved xmp.iid:262805a1-e480-4130-b09e-b14286422fbc 2020-11-16T15:22:27+01:00 Adobe Illustrator 25.0 (Macintosh) / EmbedByReference /Users/fm/OneDrive/FM arbejde/connec Aps/connec DK/Markedsføringsmateriale/connec Nyhedsbreve/Kongekrone UM.png EmbedByReference /Users/lars_m/Google Drev/connec - DK/KOMMUNIKATION/Logoer skrifttyper farver/CB logo.png 0 0 /Users/fm/OneDrive/FM arbejde/connec Aps/connec DK/Markedsføringsmateriale/connec Nyhedsbreve/Kongekrone UM.png /Users/lars_m/Google Drev/connec - DK/KOMMUNIKATION/Logoer skrifttyper farver/CB logo.png 0 0 Print Adobe Illustrator Adobe PDF library 15.00 False 1 True False 210.000000 297.000000 Millimeters MyriadPro-Regular Myriad Pro Regular Open Type Version 2.106;PS 2.000;hotconv 1.0.70;makeotf.lib2.5.58329 False MyriadPro-Regular.otf ProximaNova-Regular Proxima Nova Regular Open Type Version 3.018;PS 003.018;hotconv 1.0.88;makeotf.lib2.5.64775 False .175.otf ProximaNova-Bold Proxima Nova Bold Open Type Version 3.018;PS 003.018;hotconv 1.0.88;makeotf.lib2.5.64775 False .139.otf Cyan Magenta Yellow Black C=100 M=70 Y=52 K=60 Standardfarveprøvegruppe 0 Hvid CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Sort CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 CMYK-rød CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 CMYK-gul CMYK PROCESS 0.000000 0.000000 100.000000 0.000000 CMYK-grøn CMYK PROCESS 100.000000 0.000000 100.000000 0.000000 CMYK-cyan CMYK PROCESS 100.000000 0.000000 0.000000 0.000000 CMYK-blå CMYK PROCESS 100.000000 100.000000 0.000000 0.000000 CMYK-magenta CMYK PROCESS 0.000000 100.000000 0.000000 0.000000 C=15 M=100 Y=90 K=10 CMYK PROCESS 15.000000 100.000000 90.000000 10.000000 C=0 M=90 Y=85 K=0 CMYK PROCESS 0.000000 90.000000 85.000000 0.000000 C=0 M=80 Y=95 K=0 CMYK PROCESS 0.000000 80.000000 95.000000 0.000000 C=0 M=50 Y=100 K=0 CMYK PROCESS 0.000000 50.000000 100.000000 0.000000 C=0 M=35 Y=85 K=0 CMYK PROCESS 0.000000 35.000000 85.000000 0.000000 C=5 M=0 Y=90 K=0 CMYK PROCESS 5.000000 0.000000 90.000000 0.000000 C=20 M=0 Y=100 K=0 CMYK PROCESS 20.000000 0.000000 100.000000 0.000000 C=50 M=0 Y=100 K=0 CMYK PROCESS 50.000000 0.000000 100.000000 0.000000 C=75 M=0 Y=100 K=0 CMYK PROCESS 75.000000 0.000000 100.000000 0.000000 C=85 M=10 Y=100 K=10 CMYK PROCESS 85.000000 10.000000 100.000000 10.000000 C=90 M=30 Y=95 K=30 CMYK PROCESS 90.000000 30.000000 95.000000 30.000000 C=75 M=0 Y=75 K=0 CMYK PROCESS 75.000000 0.000000 75.000000 0.000000 C=80 M=10 Y=45 K=0 CMYK PROCESS 80.000000 10.000000 45.000000 0.000000 C=70 M=15 Y=0 K=0 CMYK PROCESS 70.000000 15.000000 0.000000 0.000000 C=85 M=50 Y=0 K=0 CMYK PROCESS 85.000000 50.000000 0.000000 0.000000 C=100 M=95 Y=5 K=0 CMYK PROCESS 100.000000 95.000000 5.000000 0.000000 C=100 M=100 Y=25 K=25 CMYK PROCESS 100.000000 100.000000 25.000000 25.000000 C=75 M=100 Y=0 K=0 CMYK PROCESS 75.000000 100.000000 0.000000 0.000000 C=50 M=100 Y=0 K=0 CMYK PROCESS 50.000000 100.000000 0.000000 0.000000 C=35 M=100 Y=35 K=10 CMYK PROCESS 35.000000 100.000000 35.000000 10.000000 C=10 M=100 Y=50 K=0 CMYK PROCESS 10.000000 100.000000 50.000000 0.000000 C=0 M=95 Y=20 K=0 CMYK PROCESS 0.000000 95.000000 20.000000 0.000000 C=25 M=25 Y=40 K=0 CMYK PROCESS 25.000000 25.000000 40.000000 0.000000 C=40 M=45 Y=50 K=5 CMYK PROCESS 40.000000 45.000000 50.000000 5.000000 C=50 M=50 Y=60 K=25 CMYK PROCESS 50.000000 50.000000 60.000000 25.000000 C=55 M=60 Y=65 K=40 CMYK PROCESS 55.000000 60.000000 65.000000 40.000000 C=25 M=40 Y=65 K=0 CMYK PROCESS 25.000000 40.000000 65.000000 0.000000 C=30 M=50 Y=75 K=10 CMYK PROCESS 30.000000 50.000000 75.000000 10.000000 C=35 M=60 Y=80 K=25 CMYK PROCESS 35.000000 60.000000 80.000000 25.000000 C=40 M=65 Y=90 K=35 CMYK PROCESS 40.000000 65.000000 90.000000 35.000000 C=40 M=70 Y=100 K=50 CMYK PROCESS 40.000000 70.000000 100.000000 50.000000 C=50 M=70 Y=80 K=70 CMYK PROCESS 50.000000 70.000000 80.000000 70.000000 C=58 M=0 Y=66 K=0 SPOT 100.000000 CMYK 57.999998 0.000000 66.000003 0.000000 C=0 M=79 Y=94 K=0 SPOT 100.000000 CMYK 0.000000 79.000002 94.000000 0.000000 C=100 M=70 Y=52 K=60 SPOT 100.000000 CMYK 100.000000 69.999999 51.999998 60.000002 Gråtoner 1 C=0 M=0 Y=0 K=100 CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=0 Y=0 K=90 CMYK PROCESS 0.000000 0.000000 0.000000 89.999400 C=0 M=0 Y=0 K=80 CMYK PROCESS 0.000000 0.000000 0.000000 79.998800 C=0 M=0 Y=0 K=70 CMYK PROCESS 0.000000 0.000000 0.000000 69.999700 C=0 M=0 Y=0 K=60 CMYK PROCESS 0.000000 0.000000 0.000000 59.999100 C=0 M=0 Y=0 K=50 CMYK PROCESS 0.000000 0.000000 0.000000 50.000000 C=0 M=0 Y=0 K=40 CMYK PROCESS 0.000000 0.000000 0.000000 39.999400 C=0 M=0 Y=0 K=30 CMYK PROCESS 0.000000 0.000000 0.000000 29.998800 C=0 M=0 Y=0 K=20 CMYK PROCESS 0.000000 0.000000 0.000000 19.999700 C=0 M=0 Y=0 K=10 CMYK PROCESS 0.000000 0.000000 0.000000 9.999100 C=0 M=0 Y=0 K=5 CMYK PROCESS 0.000000 0.000000 0.000000 4.998800 Lyse toner 1 C=0 M=100 Y=100 K=0 CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 C=0 M=75 Y=100 K=0 CMYK PROCESS 0.000000 75.000000 100.000000 0.000000 C=0 M=10 Y=95 K=0 CMYK PROCESS 0.000000 10.000000 95.000000 0.000000 C=85 M=10 Y=100 K=0 CMYK PROCESS 85.000000 10.000000 100.000000 0.000000 C=100 M=90 Y=0 K=0 CMYK PROCESS 100.000000 90.000000 0.000000 0.000000 C=60 M=90 Y=0 K=0 CMYK PROCESS 60.000000 90.000000 0.003100 0.003100 PDF/X-4 PDF/X-4 endstream endobj 3 0 obj <> endobj 5 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text/ImageC/ImageI]/XObject<>>>/TrimBox[0.0 0.0 595.276 841.89]/Type/Page>> endobj 6 0 obj <>/Font<>/ProcSet[/PDF/Text/ImageC]/XObject<>>>/TrimBox[0.0 0.0 595.276 841.89]/Type/Page>> endobj 7 0 obj <>/Font<>/ProcSet[/PDF/Text/ImageC]/XObject<>>>/TrimBox[0.0 0.0 595.276 841.89]/Type/Page>> endobj 8 0 obj <>/Font<>/ProcSet[/PDF/Text/ImageC]/XObject<>>>/TrimBox[0.0 0.0 595.276 841.89]/Type/Page>> endobj 10 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text/ImageC]/XObject<>>>/TrimBox[0.0 0.0 595.276 841.89]/Type/Page>> endobj 35 0 obj <>stream HWko. a>J.į:im[uQPJE$ gv,'-PEkG\̙#'i3:}hՎgl90W!c_JD1P$l;Z{IDJcAU^o!)e"?CKK[hz9o߾M<ƋG!!dDLX4QDѸ-rM_F׳& HR P8=+UƊG/7[_.M?T&ͳ{ T<ޒ&c`=Jhu׽Oe84VSڞx5ղӀ"u^Rx"_x^?V>ku`ltm:`oPyrSVZv0qYq?icLHD3cOq$L]A]~}x$|pj!suWO֑u\TbnYYt˺:;a3gXAqM V"F=BSu`: -MnB <_On<ۘ{yc5Y^0Iu_nn:|BV'yuH0k>=uYE4r:sgϖ٪,V=*yw_,.˦WVtw{͸&?زb5ʦSAu viAMp"bnwdpv9Ճ l(oc=@]o\p5oaXOCjD6c( zzaJEveݨ[ꊒ{fXu .a3L.Yg]/t}+v U6B-wߗ;6u{-jLY7@DUΙTox?{~l~>\?^?\^_ǧWIH_*&xmC#_Xđ< t@&~[Oy*$g'b;:{;/&$Q K;J!J> 6$4 ;66 jE)vnj8?(Df1?X- Y6\PqU6}^?) xmK;zÃ-NfPs(9?axix uft \vlv, D(0G6U=2Pu4b'5}2q$!@Ȍ6m̠JAb1m~@;-όlڽe[7;l"ehKߙWC +꩞ !|Os1?k7f7h;8TY*ں4u%tNm:ιV hhN>L?:dId28iK8VZxc--!kKZƤw#-/a a-hWfnc4]cP:1l%؈9t8}릣 N|ӶPf&-m=:[٭uȿWI5{ߕvp3`z%qcg^?ƤxI1' Ozce{Y38448yƆjGR+/q5}NL|ސ뼳 M~^&n3YS(P?aO&F!~` wW'W/]+7wE VhqF?N0aQ7 sS3ȓ $)f-Sڡ%7/_S@2?5]K n@$0 L=J0y<{z9d,#6i,Ru0 AY9ab:)@IK~,!=_(~Dx" t S/lcA‘i |&6ܳ)/A^sщBQyXN%{ wpi/b3Z!T: +$H'& HJ͘m8FS,"Oq,H96vkIEhVp &1`Aj# vcw~"y#y$O|%ߧ)y&?K7i i ܽ=`PT9r:avw`Hw6hf;+!:_ tHHAWv.To"|& :py^s| ~Jw{p>)¡4BcQqas5߱Ķqti}D/'h*;1DJ܎F>(,C0m1YǑ322X˝Y;]?跅,A_m+ endstream endobj 36 0 obj <> endobj 38 0 obj <>>>/Subtype/Form>>stream 0 0 0 1 K 6 w 10 M 0 j 0 J []0 d /GS0 gs q 1 0 0 1 566.9289 54.8673 cm 0 0 m -538.582 0 l S Q endstream endobj 39 0 obj <>>>/Subtype/Form>>stream 0 0 0 1 K 6 w 10 M 0 j 0 J []0 d /GS0 gs q 1 0 0 1 566.9289 127.3331 cm 0 0 m -538.582 0 l S Q endstream endobj 40 0 obj <>stream Adobed               (x""  w!1AQ"aq2B#r$3%4RSb &'()*56789:CDEFGHIJTUVWXYZcdefghijstuvwxyz m!1AQ"aq2B#34Rbr$%5C 6DSc &'()*789:EFGHIJTUVWXYZdefghijstuvwxyz? PX j^-jb<# F,aѳ7dyx34XVFaG#GXfR3jEō!SCZ)I$EUIc.({ZU0OT_q[- R>( m\QO9Ļ -d,[B_g By!qՀ- zAL, ǣhjgRѓhV2\j<<Kz-,GgKѢ(޽ c*5!x}dK\ӖZT #;G`Y4 ,=#W5 88vT{hd$ҠAb9u!~_'sdM:)}Ξ$Ȗ߈<8؃~As9fVGHW#Ń*ܸޏ8&q~N2B.ci:d]5:YF8QM4KR6k h, {Z *6ԓ֠#[C`Zr)95 .`'p|V`x NABbZA.74KTq8BIK% 1n"8*섙I:=yǡAx!$PF7Irp9^g^+t,E!P)͆RJ[*:cE&dRgG1[8dM 8aFJWPpDCU&68px鬔u-h {5򃭎1'Iٮ!4fwv-5'FDnh5]Szt4A!"$YSMJ)䁻$ҒR/=P̷ZWdѕ\Df #d%?L7)tՉpׇC2T̬JHfPk>L1?C?L1?CkEB||&'o${HpvC +bnFv:l$mTSq'6Nafvf> .1R@ϭh1%ʰm}e:@9}wJJPWf0Y/mK 1ciWF˘բH6YaRc'sۧ/ q* ;}قV3vi26(q6Kf}{^m$-ʌÑ(4Z,Ghf1)- QB!xA@+G58-R1)RAp~-NܣRTi !a XJ=ѡջ#_Vxn#юjQNghUJ?HX~1/l^OrjbYMa+o3"f3 3?r"(w?sx"`WWpPղ?_{VB_ Z 'R@Uy@U0(/PJ hޫQ [uW$CژWUd 1M4L7m W<٪( 8; lU ɧQt s6JoIkNPmEgdRծ!:ZRo+7}^G8MjZT,sOq 98TM2)S8G "bp=#YaQ/]*~=XmʤDl1C0GGm͆6WTEJHj)*p.PžA^#)gV/mBWoO}0`X8eFy9 Ğ6إN3!Jt4)<6UJْ-`FGªeCkC`oT%6re ap[Hk: _ RumWD gV*i(X.:IH):4 )NMCi$ΛR)E:xFexDpj27#&ԠXD-(#`qnhlfc9R^VL_>:)bS0BQlݢM4铖Z\).{b:LYKm6!4bP? 0rQ NnE/ F{iBO'p)Zn5K)\gu*~*¶"NKdZIu;um(鐚4W`@# TY7KƊ( 9Ypj/T'Xv\Qpx#v2yI ڽsLV럈,LfOrЄ|2S!iHbI*H O ɜ <ҐC*'_F?T˦p -S'!q VE >GIP ,akL@G26R/*F FVyDo^%tĠ~ Fcx;a-*eY(- )F%JHH vڦ4$ Յv uUEGJ6\-Sw;eUSadzbxeL.ST-Bk2{-&)k5Iʰ?&v|ZR"pve]K/ETI˘NDhsL$FkeV/:l2'SxȳS1"(N'2mDVi1DyrVQ01# @5NOPL'z⵵D[Pt}Aqqds'2TlړzZĆp"VRrvE)Z(xzf!)KfS:LJQQc4-݃HƀVJ1 i{VZG8)U7wHh<$Sq<:X~|AmSKWG+"Q(O0VI&Ӑ:ʼ^ |z) F(uMQuIkLԅ$ /'ꚟC⮕T*V>Щ"I[I^f'"mQ/JW/?L4t Y\EG}#OkcU[2ٽVAe_M;2qLS{ED٫!NOmssP3k>˲7 aUR).egoZڐYI Ii/MWuG=INpy[gJ|G]M*+N3ܹ6'@!H*Sh$i aJv`;ƝV4nB4'QT-];v %skKR^:i \xDSgkSruD(kpreB]ԣJ%;mO-^3~lԘU/(yLu4GD©U`ZͨHJa_$JY!$;9D58|E$ڂdI H!$)%6:;HV ۜNڍ]ǽH*n]t;G+ U2T~p꫼oEReD#`wj~VQ?۬l*IAI>q ТdH=aZ:❴C욧#Ak|0B?Ro"$F`'6KLJ5kKkK5k mf1~=={-ZvpD`.|hQ[>} ?^NL͌B@7鈚l+~X7 @Ms$w^$SFxɎ)<:{:{҃k#Bs~Vx3ߕMu61 =ӷ?bЫ;nإGr4*܏Ϲ=?l"_?v?gCg~ȇY xRJy-yGCG%:\eg>6)G!9NdA$y+քJ #I.H„FСB q}.H?HcV"uL{ {{f img@} L(bK<%+U6-ZRh˦P1RP3fsĹ ܯ}1[RdK*KFH$yF.e =FQm1D9 7&X7*.i'x-Lȷ""00u~kK/{:1bz싻imh2[K9&ؒKM|Ffl/1A:+DBR%f=y*Ps 1E_yWMe;=:&O803s[ޯ;&Ip>^ED1!)G(('S|+Zѡs;AkĐ7="3֗ܯ8R|9 nBm}6|M)G76x.8ev>`P&':mDCiSg*7O2G+l*^J}͡ºm}9[ 3 YuKmS+I)K(gINh@3V--kEaE;~͉x@o%FKKL(**g:3;?TiXbfD%H%p͜ UzyI9J AX_*.7G468̓a`@ 2u>~%S,\ŝmx:x&` ba4C*J38ѵ|@|OpDG-4o> OcPӱph#d-.i~ 2`)Mi6'' ),5XZ~rf"`QI8%'<#H;"? C=f*ltNk)QͭCΑo2-( z,cr zƒ:w'(A«w ǸدG2{gkshT$Xw DxBJ*f';l>>%]U+n\'ޞcW'"Di~Lt|_q1\Z&hO#/[v~_s?wXۋm'7/•^X͍>*?TWNug`) :T~o${b:1+ tG7VZz[)WQI(Xs\XA|vߛ}ű"tvkƸS$;hij328R8!Cjf-+bCC==H0!ʹeM6ߔTݍ^;ZH:4*vj~m*wZ[#dzSa5 Ej#"xD觘1*X? #p9 SW3VOɩ>aܹ~ 3Lt\ dw$),6eaIu8byvCIT-9w!'?K=Krx',l%hf4AB'Kgjle_U}lbb.j"'13tW)_D^Rg13hŵ64Ff=z,AXV֊=a NU_MiQͱ奇ttS9"ޜL=J)S]C$;yh'.PYxrw7 uotWVsMWgriY a.}XUÒ}ݰ_>:*3Qn^bŋyz=% IJ(jnah\a`m'{˽k,J\QHzr5(qkiGݺ:qbnY4Ǹ gk'i@#Ѭmw~mw~Lkv؏txkv؏tf綘Slq 7t1Hq=BUKdx*@ y( 0W괕*:9K!$牊j Q2RbLW:* kj*"#='SHBm]6ҳ*DO;_2ܫpDo{±9TRWP!;6 f-6Le"TbCh Jdba +Atܾ)+EQ.[ } ~q7DOѹL-oTUN` K yc"2 )98A/m/iufRnpBM4[R͞?jGS&M"-NG0d(x8е !y"OQac f-{[BIK)1(@dƏy1 "BT,!f=I맼yƮvP}U[ޮHt%=:ܺMŌIC3AJ\x =u#uko=JR-˘5"nj{g6hth]ESVy3Nq XUJ$K=F`.0ʏΚ&(X7ݠt)5"fWE,>'A @%MWfD Yy -KLwPц⠇+vS.lu)P[)uH-I^Se(M{s"_J:ly#)j;o>rbծ%A$3=|b5ZI)xe""RLE %aB̝uű =M 4'i]fq$wmn(YN:.TOdSP$a$* /͖dT F1J̐=)I!I`D1+v<rLgeQ鉦&=~ ̟(5 衱l.!t) @/1R0D+OP|P|x*hlmۼk44bc8kT"LRugIe>Űw\bVQ喆*m90 h0iUNNr(`1 *7$tKʖ% $l!)S vpc2ypQv7w+K`^?r#ʍkU:v!g~O WUeO4}RqUʃr#_z ,ϗ` 5>q^>/Oy#ȿTļx}# #i%O ZJTA0*jLDe^)s6 I>іxVw iME*B5gщ3R8ªsbHMö%5X\oe390"* K%sAc NHHHLX+PG#ݱN.-ڛqP!Nl{Ev0.oMDbQl -H.r{a7 /Ŷ.rcuo4ddCaCQhpZKSalAII!)6Tm %" ,#,XFIGqhntv4T- mև =Ss Fڐdp[sW7jrxHVKu:wF1YbFVLb<%1,5ZlxOݥ>2]<88Xiek$&r_.f>L6&xF`ᵼZiR2=)NE-K!KC٢J:&V2 hycX' ݞJ#Y~%JwdF~ 366El/1R!/̈́6DLGN,i Q" g0pSML00F72J)HPgOG::RLAur- *xΒBIPU3MACZ>ԑ)B̰Y*XTM'fUN0ҳ H)XbE]p\̝@Yuek,V%78UaWjV5fr ns8w.^C_K仩j#}q#;DIJUQJ$M0.--N2T0feJC8(k,5 '2&2W 'ʐ Pn5nHw9"b%2Ґ,۶1 Z-O4ܫm g)KZeL,fm9x0<9B`x鑜hG_HKicrd^HU.a\W}JuLdNczj0o'jhU - pV R9́E  tӐXsr1/T%#!Xv=eV]㚴, pK/97.^4jq9uBPHH`URXϩGHL-B\-3<#XȄBd,ǣ14hLeucte>*Ng[Z|8I23J&ArK9%>Zeyʒ)I:\b\⒙ЌMYBzpDpc*N P l,, DtHVq(?i$zhU|ILњ1!) 2JAO_0=#7⯪#=hh؇h7xM.𓘅 l4w!NĭBJt3L@P▶ETU,XhU)YH#qMdWѰvx& "el.inRZ,!*na5eM!&D}r|!yk%arrr9 '`/~LĜ)[ju]ti z S*Z(HO& L3\Օ1QSll@{J%9e&*&XƷK, RԲQQI' L*H=F 9m<$[bKUKEjIe@(v'<5TZu7AKkCHXM1/"^{ܨf9IX MtΖ\)!CUrrjnh9cCݴD^ ڿ mM\Y2GbjjMs($489kELwg'{X?x!T9AjFPz:nz$9@=7 J)1EgJR ,{a˒)!\$k%5@:!4{F\SNsL!E5ϙ\RPWYy+-! |{0$bzQZ}(1ޜY_ I( !7%HJ>'-y #X1|(̰ /"tDX~F)#@ 9M&wse/Dw|]kx ΢ӔekPFLeX썬bmx2DBz6xƠyK!fMkI^Fчk+J~qhD,Bư@OrcxF!ZRP@]FVR}"7 T^2K@D)xRH]U0I]N]w _y$ p%)TTacЬnC"Xu'5p&t^-`a Bi$[Mn]8ǣgxl $R_2Z) :;֑ugRƼX=D,IdҷHn5\r0ZI$2S~vf9O\odm^= } GC.,``^{DK/-$vu,pjͳNěTixjWt. dzv{b-K*a xpp)?.?J|9ӍUA;3)T2|ŴgX(A2  *qiFH+BYAƺw{iα+ mZR juH;J7/dh@ H9s]#6J$q-.H/]7ԹT(]E9UX|N$;LMzO l?s0D6tU!nj:3L5o8;O߃ܗa9;xsY4:\*>mjy&ЧNWgժ"s5pysrC[ƁOTƘ>#D ҹ4h3ijĮ 9aM"e/굇PF)J֭-C`%Fn:T*_ܱs{RK .KwLfuJ %; jDq69U9ibw  ̮G+fc ]b2;"M2NJX"+ÚPHu؁kNpe-jn*Ը'X|#Fؠ g=eOw < 8&.+  pJi}L3CF)\ĥ@)* f1j18RvmwS-q)0~uu鯭*fs42ּ$qWbSqsg)HLd1<LJpAlM@ XptH Yi"oiPԨDpEڍ"ZvS+;S SQOS: ˝6T H03aQ pzMQRmfDbe})/Ön:-%% DI,!wޑ зB;R֝"<|2S1.tP*;e$G<ɘ Kw44JK?sOt*T 7Z&Oh-c*&*7N%o8lUR7hwN#@0A$'-ak !Ʃַ "ǡYKM7*.@ʩ Wۣ.%Bg2F6ܾ8J<1[;/WǣDSOqI8#N#"([3R$;sC ľH7]Jw׹dJʃHBT[6fd:&[HV9o &yUե&ާAJesfK+9L#EG^Zd"fVg]E,ĨNBfգ,v^p'0EVha.` Cˣ,(f} Ә)!L +X@Xc3aZڀ{ AlBF">ɾj@LyJ8Mtf) w1]/jX"s+x-=Ibڴ cѤ=UL̻Ѯ*|"JDfj ]k'8͘GV L'xg?Z/Ly\HZR,ՃL0KC A_ hl>Q/"i4!ta\sHg PA ,D% ²v~C+?ʈyC%O&琈w7&k =ok<m1'pk˂蘛M%)%*TJwIFq5E$;١z,&R3 kgp@. @KHo%YaX 9w4A('),S ϩY’-[* VSSJ%wU"aeUA+"FLI ՔaWxA ĐFOwbBGbo M60T('Y^(h;6ob+-~^pR4miz4 G0Dbŋݻǃ#, z2e*J@ReEݘ|+iCrAoVKJIGmG5D\fwİ14;SH~yKbZ2JK q{Vg,ُ@Tn>B`E# 7eCLs򍀶f PTbJ̧݈mnp+2obI45A7vihy-%V3.6n-%ucs]&C%G(;]p Yv'36 9f$jrfP9l#"(R9s(6ۈm-m!~^>Qhж30 D*lmbŋXmc3h ~Aq~K\^u yQ Mݬ3`w hg1!Z{rO2xNna!fS0CiS6Ъn{8g#2[;mY uO`zNdRђI'>dI5$%Ҧ$;i$%Ҧ$;i׫VXU`ZVk|)|/~ $=p/6IBCrJiQ^2 U /%aBdA wxvB!r)R nfdJv nbmu{yg P@6 JT(H- W+92Iz?C۲8K&4$sX75S7.V;b+Vv9w+ַڔLvwqB$y&|'$r\?$&&u0B!%+nLaasQ(f9JW0TPULiA&,YiI\)+ AS”g!JH'A1í9pfha ~2}cWxとaF} '*J&`o TTR˖La E=:S(v>V$x8Q!=cɆ58UUo%y[8싎h>B7V !5ë*\aZg]AOoAs-*Ф$yXTsfQTԱ|oVTb9k/]IRJ&kSg ڊZ(Yv ٵ;;sksJ-BYy9ʤ7mm=QJH9v,I%r'hN$*YTT xLful2vJlksR1aIXAS yrҙD\O8_mru֓k0sn..֎߽-5yq~:=E̒A &1=20bLawEMDS!,JC;AWq;4, RЊ'zES;6>TҒrw<(~UUQ7OuE41]a[y4MB'-Buh#T+V|Zޒү:TG'pYӧ ߭͘͠.X! ;D[.*Tq%MйҜ"b-D͔*ʭcpk2f(#O)! vw<Onw'z2DrN'U.ZH[)X }m#R)fq+-ѡ$ UmbO5ҭW2C$bda4BP$xesZ8:Xث%6:!eHrBuFDr*&SuZݱ*񢒕bNzn$IX PHbcҞtmIhtNg_:*gxNV累;vF#4),h~w( }Jay4{go!@,$IXaj;2]-! 3ёcՄ=ůzsFOq WT* Fjrh6eVp٬ǔ1"l${,M-/ PBŌ=jHOY^Q5KLini y7چcDqyB/eFb&TU<%̚$`*7Jw{jW.DRlI䢖= Р,mWH ^D/hѶ,s璈awe%i =ugB Z'%JRF,ݭKQ1+_ѺtaxQ$hBT ֒^[ Qe}%m$Ŝ#fAϖĦkN^ Pa X堇 DNNz|( Q)_$| Qc~k3 BB@%ơ},:S`SUBA@0l"nuGstԨ8J^=M5Zg(*NY)0!l-FctWc/ hGյ<=6{SF#A":wb+Kv\8/F Ǽ#cbz0 v1Z+kKшyD$z]9)":APgCr`wRRXjRAg- 1$$ԡNz?$٘Ɏ)xͣ2ⓣ)=1(^Z{ qo͐ ^zj0Y+)T6_gU WbI)SlpY,F]jyo I mrMQ VnpRqg r eiܥW~o  ]k xf*s4O~`GCsw0#ЭQ$H]Ux'44qZe9r %Nb32uˢQEKҮj` ?[V! Ly>892EvDXfSe|FmRPThn&fx '5ѠIt4Jj_Am(, -8!uwuZi1<P/s`c"H fu6 %nt'/dz0cb,o .FI!0wkIpmpLn7.`H:z'< 1L@RCWZM3I(9M@E> eZn)"NQsa.:]pڝPp.)Ե0բ>|pDK`7ZRMt:0sܡfP$0ʦVga=(kU@:+|Z;t,~$IPBg `,u&=GA*B'wH&+1QDt[ܾijUp&xJP b) L(HNfJ &Lib,lm z6xǞ=!%*jFc#Aimd,xPF qZ[+Kc#"RHJIq^FѼ'n +KekE*#`b3 FDBI%z1hPBb7RJXV fa/Q0R#УZ6h׶2Vɕ(4hTPRI^B[B i`Yd,4zJ#rHl%` P(\Omⅴs_JCbD|":wף?+@gk%ibBq`m&bŋ11hŢWb3h3Jޟ|؞x7Q>ohVݣo\N q@ CïIGrej69&X͞):O‡zf  ns ^H2P@4غMvhÚ1ʬN۾6˛Q9݆mݬOH[ X. `Br1PKNM,9Z%imza vb0P rS?ev¹0Įq6Ns-%IṡfvCRۿd6AgQ۲hyW ՙe+s\[Ӣi2;iÊt)ssoITV\a+T,1f6B i+ȏ<`Ɩ,dz3^=RRWѸ12V,^hl#pИbz7`#Q vFJ^GnF鄭V#Р"7 Ѩ6bJVyѰhPBbH"4B[%$bcq+RYtl#Dd%Wbej#qB ~+Exǣ)}aq ! JF!hA&[νfPi/0n4#yACSODYFbX${{i߉h8y7Ֆk: z9 &bwƋ1gpv\Z+{JA4Ħxv8s`'>[Ei *QQXAGe?K?NjA9{v]Lt)J 2E{KIJ?V2 :LZRTZVÜIv¦X KT4M.al8 /^0%ФC02 *Y/>l-/iu:gTj,ʶ q`9G7)tPp^ Y@N^bJTeH&jLuLF֊ŋѬm1cHCOLoqfkλDʃD6*R5x@09Õ=j$>H<CJCJplQ唨֤.wQ($҄$.& Gx't:dOXRXNt.ZUv!ҍ ;b-CgHx)t:-挥cХE ۈeR7r7x]7R5hr\<(*>ѶX'1P;a( p3jPsN!-;.5)g0R&S$z ¨HEM]rH.{(x )37(ZS2ZU,w< eBS:̅ȴ[܋C)b7yN 37qh 3yև.BѺTQDIJK+Q P;af9JTu` %`y FUx~J] VPO&/(r$ᣡsN &l%Q?<}bc/KPrmUSn*ruHce|S g?GH'vG0D5. 5c{PZĦ끨(Txp F,XhF;<愬Jb34z4E+FƂѸ1'5Z+Z1kUb %V=6<n):ohD($V^=FX #`IJ)+ ¢4FI+ј_5hFXR\W25+K Xn9B`om1. &"6y` 3?Ryq}S}hrԖXFB@M QVMLyjZհ3\;N Ar+Z l {# Yy=i--.̌b8IWuivo! \hya%eGsGdIRf2VLk)Fcs[7ip"øzTH)L@u%jPg5k2%A _ BP24\E־}aHMMՉ"OXq V:h"?Q4*FMӬJʜb6.ҨIS]aʫC:\P#UDLZT+h$vjMH2'+6U%$z.KcMԡtsB^wK9[\ u-i˵e ꈒKcUPr7\$W#9z*I5W(E$Ct$;tf,d/fSgH[ Ηf.Ƶ{96jM YFD'n q+ƒ a70e0T&,;i30vUx]5IEhdM 뤆v.a&J3 䀢\ܝp) 9Nf6ћQoFr&derco8t1NF>cԸVw4)iX!uftq{*%sS6aub(%*n4$M‚U0Ε:`Un$ԣQ:)-f#Hyղ0ShR.q;2m{":t',u%l]*@CD8F4d;]ՙ.l<P1w,\i߰[A-=to:I A6Uhp HcpkB\uq\RX(m<Vyim}<G.o Z1 nޡ f\ݝCy~jҕ$gxdAX8шe1E$K`E zbIvդ9՞+jo|UcH46/$ v0TOῃ]C~X۳h`LG\@QFHnvƅiQv<,K IM [ EG̲N@a䴂U dy@ wq+2<1Ѡo%ťvn\;uưZS[khu l2\rSfm~zGvu =KG4=%xp7myYnN_C wF a %Q, ! PF#B]]W'm9CeI?s0Ciƛc'BL%;蹐`aP>=e@ogf w$5lP/oV+ )pi1ca36}lurGyj[\ԉ@Ga`tvHA|Jxd%Q5ah֠lNh-ZMx&,%s,!4\\1+&P9۴S}/(Q-_z14ɽJy\lt\ejG whra X|ꟺ!%BJRIhBC 4o&LA M>O֞I}CMf =TL)pbaLR40 tFetFw"4Q;2*Z(QU ;I^ ;$(j'QF%dXuRLPt1E[vd{k[3Ss `ʝXq&zuTvéNIj9# *J<>9RZ6Ca=%at/)yĪ0h:zrK?f(]GV\W7hA%`%C"QbH2ɽJE8KՠӒL5G;X5R,Z =ML~ ؃)&@E֞x$I'~ȿa'KM] :q2CCZgM_=\+F֊ŘdFDb6V#Ѹ$FF$J%$^FnxȍJz<7J+7<lѥad̬F##Hȼx F4a+RjWѸj({JI+0c A+s)%z= ߶5s %hdfQbf8Tը$Y 0W#5$Hϳn-=uZ e@mDjOlwWs'd}!nfD>]3t9h|2J$KG+1h=Ѱ1ڭJ\7G.*2 q>"` sq0LdKYAsHgh}% 9[1˻>I*-=7x,JlFJ }uˆZˆ*S!ȕ2hEOKE=BAt5a}\RkL=Eg>ʙh{dvM*ѦQe5k)[\DԴRb&.e;̔60CH$ܟpHĜ@ M)R$L=_gBs gѳa s*O`g8\mb]E'"xos:@ܛae IHm$s1G-:3.l[մIN)X)R6z"0ґQ39HP}5ITŢ@ s1vwDKvnˊ}sIkӐ0;On3)>r'ȍq˲Zb9w`ED6L1 =#HV[)̙Zҡ0X[XY)9o~؎r8Ȱp{"J[~zFVwlawibH(Py)"U̫$109{bC{h"OFxU*;)U rq>C5 rkI`n#p-TzJ@pmߜ4 2{ZtՀ\[]IfxbzBKYFauvD\$yGVvbуښ,2y{5(A$im6ay`cK MƞU7$ R330O]]spfB57, Rmw%vp'12X{,rR߶w6Ik\Xm Nk .6UF1F1L,laKZC_0)XL$a6 )sP~riSTWyd}b1L65TNtmA;7P<A Z&s 3%_9b4\GH:D$)%NwIwؐS):U V% !̢>=+`TL!ѱ !B8Ȝ+҂;VV9WF*ͺ@ f)%hTըK2h XM72q]MH)[!\C.|sH̒ۈKPL=̹Q%JUeE]bHJT |bB]n/ Q-@lHK\ F}ii.`$̄|kUڝL":J-jDGbL@)/EYT4YBR~EP$8HRșgxM;w5 ]$1jU> 9+P" 4'¾\(Ѕ|SPOXfU!O&_Nj3eG/ݦؖ+ϵ* 1Cu턘FʼnFV$GF=,IY+=PF6%hVcHne6+%$\YM2M^ 3 kwm QٔC$j NLP4}hsy_>@=z$h[=LI^[KFz/ ʰ0- _Iw-hBU#~ȭ$7ѢbMtK )SF` _L t_^@|?''t8Z qn^@bLGMA:Ebr)f} u$1t.Y)d@.r̳d ^d$f!Mۼ8Q-'pMI2 F_\^m  j8d 椤kǔkQ&pPd rsC9%TQ@*%VѴDz6$1hR d+biJf*Q_U# -ӟLzIb%'b[iűLv\ . CX=f5NLVvq4)-po`&Th5s9OLRSJ' SI>BBw}ͥ#p%9xrnTt `ÿ)3.MY 5gwCJ<|"Ļ(dk o`HM; տt0Xb1 0À3)%'QqYn@C__3Z8H b9hol)-I;fײI_g K`˲:4ƫ$3\}Avcs1=#1=CAD\hm-D-OYgaٖ\atbfqm9{u0{;aN]{Xq.ᣠl-Q]7h<4а2@<#ښ؇r,~-~$9`{"/He*'t.DԖ\$|\;`E}M}$aʗ)S_2Ґ hWEp"iMȘbrK$`5n DΎJXB=;?5hsh]ܤ/LOZ9j3 ؚ.$C`d4wƋ՞&6-SqZjRJ k 2h+( MƤmxߣ|MtߪIg J T;b^6Lʘ RAb"ŸWE<R&uV#2ԁbHq>+kՉPTpJSΩAfԅ@fr+Enzвaó"<]:[]hjG'V6*Jr{ i}!TJRꑿ`ge^S}R bۂAp%zJdc5D*iDpMS(&rڔ]ʣ`O~0})B,~\e33~FbH}O ^=3؈0>|#G9UEza89"},n] |=ؙSQ=Ԝcj1{Lnyf3ЭMf*%$LQDXno p3iJij*AӬ.94:[Pog":Hy#I @qrڝ;In!vc$lvhW(R$O&NABC@ g L@{C= z`˚D@. Vwnd9ju"\D}bo_-R GwA"&dZ=](D<@$^H.A%EH jBB[_(rdLFTxqH w4+%a,Ec[H~>[洰fD65gr=xjcH ' z ;ߺޮ*O΁^/%)Al dť7`fc*&% 2nOn |{ۜl@*xRI @TxÄ@۽KBJU.z w_=pG莍w4\Z٧m2=\G&'tې6\ BsJ)JI[$RĖ NL E$95_җ5gcB]/pVBdf$Ue 47MgzfH7ذbI]%]*Hş=)%iKX܋q|jTI@,GdXjO-]fѣFF~'arpCbW gEŷT!j*H yDGP%eLP@m4 'z:[W0YU)^s/Lu'BJLXl(9}'fӢi+ 7WM\T#jogiWfd <c AuVFhA,ƨ0ԦnpW3CȬ.ri-kQESz!udB L&H RܵtDh#&閙g |St"$(nNJy ܔ!Q]L=oG96DYB0-2 |O )7xZ]PLۖ>Y4Dn!GT̊DAr PO *ZEsn^E_= x}^71aFѠT,0y#@hJ r?NP|b>r-bͤso.LJ'I2SȒ˳T*$uJ֫%h*a`$$G"6<4nahRIZD,;cn)+D/G Fx6Jr+R#`41Y+Z/G7apZF Jcё $ўHhXZ!dzp9Ɖ L-%-F6MD'ElxFdec^i9 2 \I{؅'0b'# !)+;^A.Hjn|d\hbQbzDT"DԬ:*BT wiOT*2%P D#`CV hWKNpH>7\@ Q-dT:*&uQ,9ԒI2҄ iK% aX.1jw) @Jm8)Sdx*I nCZ"Piƶ+4㠒 WlNnr${ ڛhRXCŮ Ivm\>}fȗrmez$LL9/#CTЩr3GzIKaI<6e^!N4KSD%`p7RtR 1 {TFPdĴ) =\ToT,mZO7-}W53ߒhnAMhUG:z|GW(d= "#11N#PtQ#GG5>f-7X6%=u99qOӻ; `֌gA1Kݾ;w'8Zy!;Fqrd̩.pW|W9h/Xچ t:f)pV%b,5J-(- Z,.I"OéX[ir7F:h9oU-2b35lk84Ukp v@7O&s[Λ+-V B•59bT}ȗ41-6Ie$Z U:U4( `*!! hL_'ҕ0)K"6*E%q2N?_?Q(%K! w<@26 F~+WV o"*훱i77s!=d+3r$AsUn:DZ%JQ S#UEWR"D%%҉{$R':)-x8 PT%@sEG%7igH`L95[3}T1qLFP#,Ԍ 2pAIPusb@ ,IPI/}B QئOimi-LMYS$$CS$^m"sx!YE,ց/vǮ,XTb@(H;! {Df_IKiZ*g ò?ЍĤ 4NHR;0c+MJ^D!Q>qI <&b6w^ /[P9+or/LcM7 8+GJ@;^rL` B@s^Y:ơwHmzpuGZ *GFkޞ:IHbPQUK\ĶN6%&JZM Z1Ѩ\lZ+J^Ry(8h$R$"]ZS PN{S֡Z kUT/IbANf56ĸ5nIu luʈpD6PGX-T6 pXm>e k9@B~w-XTdKLRV۲&(Dt0Rm[=M}٫W0uuRIN90JCfIf]]\6U3 (Fe4bKDMRA"tMR)WхKdVdEXnS sktG5?eN n䟎脫s$ك@Ǥ`+~褤xx8ڟifՒ~mt%h!/$j![H"W12#cA+e%z=Dh*[%$Lz7H}!P#a Ix)xlѢeb´WѫF|#q̭,XWр9#3µ !z=<z3V,XhlThLnV-jjDfѾc bޫũn %F-ј11ƭn޻T4rB/ NSwy9je;»-7I&cM S[IW\3:YzLYoaMT=W JJP yqeGiU3#iFGMTP g =xkxrtM±Rs"^cp\յnrje8kP6^6bMmEB3:C;4bx*\ZlBU9%ƃrZ~Ҋ#1A)Pn|Fΐt KpP<"h3~7 lp۷cjM8.÷$?SzFAȂ5 k)<ţrRKt)١YT }ࣚd(!bI7aaEn/k'DǭQ1r_=cMQxE? %}[*@Dd.l `ob*܃$€%7n5>X 0 &sSKYb'Ttʐ!yu Ԫ[y|4])Ҥ*PW8+I#GwC̴;ix%S!)(),2woHy.Oق:w~Nd;ߘ׽/S0)}R 0(a8TSjɉT} tFYԭVl SMŲ)=VVHFp DR=Qx4OZmV ں7`ljIZialzI$d evY* (msb;SʫDE(3Z R:Yk ȭub7F/ QYPjHŽ LIW,f&LJgS0܀ Jё{Ыn%P`6hٺ~*@Sk7KV)Ғh̲dܟ(m|3:|eHSQR:R䨑}5OK$: ʦB@}X&]G?aw[qw72=N`jhE!LX@NW6z, D)@$ YU*F3Ȁm6;Vҳ:+*Yݡ"h7xTTj@/ɓj'*d]zMB2 tEn&JYqMw9AՀ|$TnwIJɴQQS ˔V"ZJsuR*p-00y3VR ӱh;MJRYQK,b>kMI ԩ"6Udm 瑦^Bv٫&y)^'u ԤN^֊~ 8jJĎPg2J bZH/_=drT{j( 7E:N5Rxfzbxmz{͈+yOx;-0|/pɲ1RU_X RIP!jTa s2鼆uGRkd#.ޮx(Z<O7xh>(Hh9t! qژqa_laj$1Sép)P,ިb -hôCzKu瞕54g$C.\RCs̩dbQ& pJu[^Ia;к׹Цd0.XJ\2I&&q*tH3vCz, ,?h59DX[ǔIQR%k[k {7 aFk:-2_PG(ԥ ,ڷ/cKꘌ8aJV\c\fvAH ĽzJU}gLr`(ݩu(RYP:tOT%KQ `E?|X8E"(U2`TOj,$࢐Hk'E (MulliIFA0>)H}[@Zne0jJzgh$EͻR$|Ocxkf˝U8$L='] .TuLdHs56W\JyLNI d)aY *diFsGI~yRSۢfiP4 z5]'}xRf?UJҐDbv֚2˜>2뉌6hCԨFe4v)=8(i-Lc n &)2CړRʉq?s 믌FTm/fd9'՞+0,5gqN?_#l `@H?[]C -b?7WXI=ԗ;)a2XRl䡋 _HƬԘ,Rrgl97-fA sss! *ǹqhfdjbBIJ eeK1w};ᄰ`X7Ҕlwݐ>kJܳ@L>C%ۮ QFf{(SIj:OţtI ~UmaXU+G.o5K"1_1k.Ai$3c.O9g\O~ԶCu:.bq0`'÷~hXXkDsrX !8F!YXA =c3{|4zf`/so҆p+`<ZnEL.x1s8TR!-KY -Du@T"qZ _ڷ=# *I 0C!= h, S%&H%"QPGL^SFA"X&Y!Α.]B@I$)ENFv 2r¦JTae1P sZmjAa6S% xmQr%%m8bEX.i}6O9gVt΅H!nw-y톥'4FTKPL.aBYa*hi7¯\f逫ujn.aQI\d=Sshp$@ft~\.55*k"V]ntmH|I%D^RщJCLH ~4t?Hf64YZs$P'FcV^^b,b5 Tv\S=qޓb,zx&5*t.]nwӉM'o\_D09YjI1JA+hdsRL^1xY"4yF֡bŬzHxPBb7ňldF#Uz3cxmz=/KadJz2#і4VԬǣ3#E`[Z FI[+z̠GiXFoUbufM[$9IZTRis$f8MnkTǪ崚A{'𼇊w7ΘreA)rl lއJ؞:SQTWNj)_1om%]BA)Qe0ֈh ,cYMhI3p:gM(NFiH#2e5@Rnsa5g.|L1EKZJ;mY]Q̪Y6j>@hЃ 5(_u|)pJ Rx59&-# MȿuI,!LLs8 q#c jƖU;T°GqS?.ދ4r ;zN̐#ڛ^\2r,uaELOFmw(NuaS3 @ C3CoQ7uJϊqVVL:$<$I$ÙX%lA$=ߗAf"dDY?{V%%ݻLpvv)eG\]^iG%ozTO p) 9Ź1é0eI ;f:us.)5.O~ FDqBﷶJBEX]Z~6.׵,G4 P@,/K>,)Im"N#aTpU[)w>Cr^S,ua F`"6jr)+B,<=ТT[DuAjז[Kš/Y.]:܋wS5$.o&OQRivQ݄$CN5=b9rZl j6B?*q)뀧e s*zҔN#yf);Y3.qb=j]9w1PՀH`dX<(X )3@IUn jiB2PMnޭd|_[ A(0]~u%)pᴄͮXu-]!ۙ hO?d\k$#SݻUùxB@So4æmH`8qEɒ#^+&s#3 /լ7 e5PKat 0 W|,7M'HRXP4j# #Rm+9s&RBJyT[ݼLr#wUE a:Dk(e7pfgwb>-( [6|spX3ɝRvnW7L ٻ\QpJ}c. Q7>ӭS%pLq+;ԍݒ8Q΅Nede5J\FMfki)pt:{b(Y%CLUS+UgDz%y;KhI^WdK) ?I\D*i#:rƻc5= Uc4Ω; h+X6i ĩv4%77\5(E@xŸ2U3$5>0%"d,)nXxVԫ{cZy534uo0,4tg<qЩ\T8 RQ"M'3ujRFE`̔9#VO\R̅ƽ=)^*;a H#X:Љ$]c#g4 d3ӽj$9SYplj8 3)\+N"TY˕A/f%hGYR@|-6K!V V *ڬ2T v"Ꭰ;7y BE]*RIܱGêhnI(3\*|f86T}bE3zNnQxoSS`e (FT vRF+!5pPRna%5$q\X2Vd\ hR9Cd J$Xr)D%T9\ˋNe)w!(a}aif)B52{BRDz4g+EͲO$HJ4o-©kB3Fڼ+5i-,=PI9ar$zNލ$ԧ)Ъ䶬"6%#vq%V3cB*Q9 S/jnQ@FB2oo`JS[s.Jt)SBЦ#wlPME\m.p!O$%ԭ-O8RI9Fl9DM*/4@!We* rgëQf^D9OAؙ*a2JY).ȮkD×MǛ>)Ե%!O^H=4Y_hE^C]f-UI(JA7Sjc)5&`7}dQn4piQULb;+u7k:z\Qu=ȴGhls5wiTVa5iAZylߧaqdFmZ(+ipɆDe4q*|dO̖Ђa\O" ;LOVx1SQ3WS~ؘuZ`q`[ xЁ.RH`RI*N< D38~ }[hAJ'_g(J-&Aw}pAbWrAͯy%9$ 3xnѧXV%e$K~rL`|#g!ڻ43\'rhMfG;\(6mQz j#)`$7Rj90C ÃnR[Z!&5‚5Ul-jRY\%,yIWзns3YwG1ΤW'Nkju$H5f\Ʒ3mpc,%:z7D,KZ= [.(˴lA;xwo ԯ߀G%*`Z.Div&%kVP-J>`Q (6EmBfh`L% ~f&JΚ/0\>Ń73):T!d2Wn=GԱf[XS(j>552U1D '%tfe$*R$#It )5r-msdJҽn$hʀb ynH_5),G *q KyCScqS0{^0x^lNN TmaT8'5nSLDS+QI M}IW%iO)$ĉsgN0B$%0GjE<fS!y:z)$$ k!J%*3(khDjZr{^66ߢ*x mA9*BRrHwOQ2`J$w=R us?gt9q5X9N4w8NW:U= BOYTtGpHfjdO3Wki0(a*t¥ͽu%)쮥"*:7)-X&ϪNIH* ׽6xoD ˚ .Y+IYBs~C˦oHɍÜXQ!˒MaX>JKӊt,IhNrXL20Z{!k6a޸a2yD2m|WqD> ˳|Ɲtw&WʣgNVTY<ã0;K7Y~Ȏ[ї*Ȗ#.6FA/6ߔB..zH̞-h}[]i6Ǝ~OOFٝ cFZܚwR6i=O(1^bF-2YI=D3mEƔ0>iIJl|O*ff'+R{ FBx'NmViR˭]9ih? L,,>h,zSk:J P8ӲԖ˗z}/LW4NΖ^H[FNvq>{}$Z [#mbMZ*YJ)!uA6jH5ң;M&RС55# $3jӡbP\d JRVI)b5zŭvX 'G2J*-]o@.2D:itӢ<8'YԞɵ R>7Gڔ>Z&f0 GCM"lI$_h,Ja5(Py2J{T3PGіX'*ȗ):$h%;/ dXz< K6Tlͤ pMSW\OVw1u[ã1F&3gxX )MÈp)hEt!Ƈ!7,Dq=5RO!]@ #t w2(E0)%-h)#)Vl//ln\Xigz\> "RYhH[k%>p/aɍKSfYGr4OT< Pg)l)m) FZʎ4V{ԓfFCv=}cXy(_Pa;7Uޘpk]4cǡ5rmm!&s#R63X^@l . I+ahƱTFd[4$:yBJ0>Ƴg5d8 v5{isnO9XS_CiNOsX4= us}-<%˛nѭ@n᯲=P (kժcgʄm>@6`+.*rdލ 9gG"?Пt:7cE:RW2gQ v 8dʵ 1D͘PŁi>aT13+][vעYJjjoJU:Yk͌k_-a"H%HW]#tnȒ!"dtu_X~^>},9)UL35 q)rV`U$㊙p ZU4<+FT9$K˜!&~D)YV)õTIDJ(n@3r,kyՔ KxtڍыLpifb͵TP9RwS*GOJ7 8m74Vr$ƴrp=q*'6(*g˚ග'֭2؀1zIN#*! &ϒ]:ٷLI:p-o֎<l4)iZ8%It3[h*JV?DBVT0=`^&VR4kگV `k@$Rtjk"Q nN :wu'G~M!@Mb GMKS1l^TrInѺ!il.\l#DJCZ6V,(P"+/Fc F,Z`^FmnQxܬ%j/Fc"cѹ[F<&pIIPFcbW1挈$VcdG&Bťl/A6xńzѰcaxV&T«⮊MjGV7P}R$[Ur3` : I֯OU!ҁUEj哲Y1Vۻ%<]ͮ {*|Fs#ܶ@:zօD ;>'ƨ훤P""TĔ%bzO{--z*4 #x1^Z_8n}Xcۼy:@WznGeτUbޥfܚEAavA=FVPI!9sNc0muUA4ը;: ,2RO0JH{y'*E ī%Ӫ4%+ ibԮW!P4Ū&s8U3:g*fk4\hɜY; L  H~zQntځ"33KHY(6K~riG/JVc* 1&*Ux\jBq14*dxU1z$ btw^r(TMa Z$=O9 ħgHv류JՕqޅmVIon2c{!'H9z=e)9 Y9` UbPug81^,*>RI v 3Ha ti$'3ϗyO.pG~y5$`S;%ֆ/x7߉zBt%dΜ 򐑻DF%S%͘v tC `zoD6'_"BOiTY{"q-=Q䪶qYC*yjJG@}tL NXGb)PfY,:[hw7Z( o!rhqS.#Ώ6tV/2<{)-xf眧:$w8Wp1nQK3$7~JNNexYXT u؞][a-@=f$}qĝ|#e\]-crGؙ;\ze߄V[Nm41~ yO+$Y>&%wSV9$dhYaEs')Xn 9 MBT4Oh~2e$ʒ:Bg+ZӸymmxhmߌ<Ŷm")o>~n?7>vqܟ<=ֹ&)5@fU é,ԩh'& xu-wn3RR*Q n0EoE!M:wϵ&&Zo"ZgUI@Qtŧi{̘t*=TF5b "[R|&RfZ3Ze{6ä&08}VݔRkCf\sj-R3`'&C3itӱ"V]kHb\FR(IPv5cYT ~K ɇJY/`mI'Xhf h7z eHͱ/Uj|fz*2v]. n%! ۻp<+&j-#T(*/ŇzNSc ]LFUP4?8vM$E2bs3[y.0jsLt#:BW퓷*)^~jFGt/$6t<~Su/at(/t-M5tO&!@:~IiCq-^P'/PIu!cT")U,̳r9L(aD@i('rWX;s)lPZd Cs!39vSd-ԒWk dЊD(4rH%(Vcn#T4y+vFFJcKKd63FDfZ/FD{Hf0XV/GіXYGǶ=shb7xFa@$L-Dz6xLFnehX3XhlcƮ֌4V,+kFc8љ<CєH%П~qBÔK)N{Qdౕd>|*RT V@JS9y:[{zpW,ˁ9D Of]1w\uG-t*ϲalsR}z3:m紙<96کo 3oKkC49t{XH85#)t$㔅)A((OY,!4{78&Y̕ѩYI0\:ɷ2K8m4*R0 s22eJRlӇⴓ*S(O ` )hgE2¡)Sug72UfgX}ʼR4z7[Lor&uifBentR`Z&OQJRm@'2f=ɞ2dɊhV9EJ.{Nv!j kFTMPsbn'6=[ZYP88rԄ X=n"|89<'C:yوB]@@ԓrɠ=yKJR V~!8ȟ%#2RTl =alm:W]::ҥpζo9{ =jma{LAF h(ָ; ѣG`)K|a(x5J]V-4A9,& PԶ'HpΊd,M"NE~39dTu]b[ư !4}ej\],ee+SL>bjQu(cKIs%\NJӰVqعԿpw)Sp='OjD;l[*>QR%)HJP%#8ܖy2\dxBk4NZ9KFˎIt]i|xg:y,8*f$3Zs(}<#R u|ljzY$M06^jhϵ6;;~i.;N_\?ͦ8qý,obG3a)pXƠL3 OWDCU, mJ;©,w zU99+t7wkIp>ѢRڄnavr=/26PGP~IQVTQJL(,DDbݟ09:jRs]@aa[亦XT`"j{ǷP /K$H;l<[c]׎rhjlII9' &c_H1.&s0.b4ncR {w(S^I\>T4×K>Y+0=q L0{ ,h_a`"jTT$b5[hǟْv+wI)dd\u-._ $Klz7Н!WFɎڮ)f$7Bk\vw1hR@^3 d޸I\ݞnHqRȌF<Ʒ0o ( 9j;> Yf l_} m~Bb6~~ Ǻ3RǺ3RX=sap[G"ި"ඎEQ2r|=:f^QO`aJ:-'.:";d9 TҬ d*\k'%-+HN V%P!HK_x..sZ)5o8,1BLȮw(Lͳ JLg rTz5L7*d qhZdtH被a'N-ǪI IJa*h EV)T5(R,B %Ahjh-<*H,W&]d7f*ܿ|KK\E}GY-L5cawG3qf @ޤ- )5e0 }glI_7(ExɪZ@/_2K/ڷzGoHJT$Tk07j˖ 朊L@3f^RM[K5t97R^O>m$J D)IZ%"W'qIqXJJz2#fZY0cр,#Z+ XV#ѹ;ɉ-SW`Ig-Sf*bRYVN$=CIhRE7/Rr&HrI0GOi7KhѤc 18Қ߫RN}ld='Xޚ}"N>#SZ7,jZ7)*,8bT5;s<<#Sm$Hh,d ńhTG3+1ei’%թ !WՊJEkT(Bֵ0J@$Ì_-upS3̞@jI9Aۊ.si; x'qk^$Ѥs &4ޘa[\01dz,nK xen5Y*Q:j@ÚtJ@'A/,7adt*X1&uhI~:7[S Sip*{|.LIo$%?QKO(l@(CrAPn]5"ʐ?P57>rkc1b{_9D Lx"&cN҉h<˿x%|F]\L0K\2@HN "YxEWKI%S,4嫪$\1O•xni8x!:@$ 23$DNHrnO8$l2F *h&)ajeJFbk}5K fS F3ȉ mVhb<$;!=f}:{I=!fp8WJ.įh2=ѩ0z(B%$T'"Rh[ fWWFyiH)k2$)9ZvAxêi)WTJSld!TrJ3JIT eJRqE (æT)L'!]tJ_ib@>G{.fI # ݱ"Ƿh͔cZp]30{ ~I~o#zA$?nS9x%=?0~;"L )!KRҕ,+pxéiYJ3(f:k/1Jzϕ)E3FJԲK8]%]rdY/Fof 7hcu, uRNŸ^2mh% 1L2IqOԥkn5:&6rt}:NǑl*iEY"JP O;Z(Z.VOCY&Z:y)LǪ%lR2 "Ĉ x&ORR,ĥ oT*d視*TՌ́=WhT%^0IT!KFS¶^AR]PLjFof)Nҋi0Dn UrYFGBL;IsTI,_ȗ_Q6ZDʩyd*yTs9b@f3(U-eXJ'-LWyn@ɟVUV\ԭEJ>'nL LxkwC+j]=̃v37Ǒ?`'4W7h4%`PD Œ& չk0UXR6%܏!V` w0$%ѡqsypQà p'gЁ<Ԩ #` Y$; o)re]) W=JM73 "lloI<Ӻv4Ag'Eޥ-gL{Fzw-nc6jQp(AS{!dʽ;c?D7xӮ|Ip!Dr.n Fhǡ06c?a{R$?4Jר_R7ss)M24:BiN =Jc-㯂cx Oüa7/r,yl!KNYiv aĜ^v{D8> p*nї[է'39IJ@T()Xư縈3[ +ReaKX{ݣٛ\qZ7lox…8Uz:K3kgo0u=J Q}\Դ;\FQ 8c.&R-O2J-{}50\ni:j[L%12RWb sV"@SR*V$loow~rO흻vdIp2`2ʒIR:6RHh59kچo"Ǩ8VapLM.#'ВP-ߴÆ9ui\X .4јz !UFnYkJHkh[OA!!Y:ǡ%?fK*]߸&8rq:B礄F`pB{6YP%I-hr ;7BB at,p!c `֏CUO{~MZgљd[G2 mЏ{ Fif2]M))c79_Wf hKH)Y !ZV%/IٜyhqsӸFBaC=W{]>ZG66ޅ6#IQIֱ}F iLb`oB%$Ի,6L%c}q9QCOc@U5A3'U1_[f u*#+(%XqXe(QQ*2c _C-u}5jF^ks 'II :ǰT*l u?dLM$-g^)FשD/,A! @z:=5tx^wW%NJQ|oQHaӶW&D,K0*>W8*JYӐ_ZTI}5?]|9;Ӵ(R2ITd$d-;mE2I u(w7Z_6x k+>hCjK@tÃpv1H[R]61؎OTEwz7gQ8X[1_ a4 'I!E4#ax`՘D.|'`5+R %z=2#FJFa= ֊ňnјoZaa^cXd`FjPGbzgpF. wGTA1/9@]lܔ)KMBc ֟|pZB͘*W`oHK6gŤԧ KRUʔ|%:OX һa=iS2JKM(ТI;6e0*oD,Su"9e7VZMW귴ڥl0:8[z0`ܻa8x';9Ć˝=b9jMUbf$}OgUVN͹IܝϺ3K\y;M"6DCI9iIU RbgRshÜf ֒wJe"Z8I){ řs_rMìK*Tht hHTraK@ZҒX(yRxE M%<8Q+J%̔ܕ;$\%%DN-.f2BW+Zu*[K$ܴVh7}PkI60 *RcpkP*\Ϫ8D\ uRoJUsw{KkLH$ZvԪՍ@ ̄p9$T*t_(R|^P]}u?S'4N1 CΠCi5Y/_B*RBPX="FIAoεh¦ˣ*K "@*=USJѡiTˆܝ"G%>mg@ X} c32YUιphp{3Mq5]GIQ%JA:3d͸J@*XQr&a%NNf0#h[==*s:L©*kFm9xMp-1ٟ\(r XĹ'a'cdC{[JTO<j lKXd#`\w%+6j(@lmOlh>b.{PLne) gF4;2x-,cr$#-=\G~y.LwYtd/DuNcJcZsِNr6*0 d̎ys^ 5):R.`~gF4l|ckc iJqBte;e-oDΑڸmG|I[;iDSAaLTUFHHRBLTp[2H`pJ!`~Mg={q@[ddx*bϽ: .+f-`(fA搄ܨVxEi*}s̢r3}^6X h#UÛeA]N湴|8"ZgX^bA"&V!3PEݵ=DEWQ.N־Uu l `!2L^B2 N]g8K/bUH3;ѦQR`*Gّ+ _iT^wgo59iaV ZkM2փt6<%1ʣ,.W AʢeKzXQSH9yBUL @)Pݬ@f.X8ʗ*HL6j2.8;㥍'S,1ţc=4;3#vC31:&zJNs`=fpUs*xi;q]= b!RI2g($f}uqa(6bV,ǰľ)è&&u-Q2AOAW-*tRKS8~"]E<%a%KRzD!ʑJva÷[%t<. ,s =vi  6n=Wٞa=,|(p.$ppS sа1򇈎Jop S.rNReGP+*H}L@8js(I`# }d7-?,`ϴ:OT4@m ==vGIZh^= E`yo cNRH{gˆB'[5H;BKK;..yj!?$%%j@gVFlPp ]DɆh Jko A.i.ډ`u'%޾Ц`Gtq ]Qfu-UiʜHC8RLl[V +ߗ% h .#9p,J$,t=?g6.LxBKR݄% +k‰$BKM0}}!;ڶZ#³`j|(UD% R14ZRfZES^U%s'QT{hcU%È+Zb4oWkմpsB`{ONS#y&J)2G(锤MBGNcX&/%rKD6lǏSOXZ(*wPգ)G$h (٣d y[ Kz/dF𘍄aI!( 4 k3b^Gŋ&Jf29GZ=Y f=hdFl;7{;*3V q\UE];%|n\U*]G!B$ )=e$kĤ9KWwlӬ:"ƵsgyMK r$h ֪ D)l-=lD R[k9$14oCȟ M[.חIe<g0[A-xtm֪fNM2{*ԧ݂foHIq}xw[QHc8 ]wrͦbaXnt\>3h- SSϮMN2lեBC-E0i+pp +GΟ4RNP>y0<0ԌDž%2)uP&jH1تМC|Jf5OyvZmJ97[:9ow Isu,; HZi̳oN垨7#+w(z$aOϜ7rc 5%7sނ9-֢ t'$7:hxQ|lXmOXYUmMaS)ylZ4iSUD:@I?zmRwbWfz =YsFC3O22_(_7SJAżINf eH`0ױKu>I\'?T.-j\jh}W.p{ـ8~#VNU Ht2['_jV wʐ *bЗ.mRN-jD R1; IHXlɓܒQcc:KXv ܴu@*Jftl.&\I Hͣı?m=y5 L乸eOl%UOzc7Nuk*y=Vtk0x_vF9E{NzqrKy+r3<`x_`}ђ_5<tq𩘴^ IYӖ^t q:vsG0D$G +(Kdh㗀G6gQ;&]֒ꭢeH)HSn59r3"I^+##=!7:md$[x1̮X;Pt&HpNin 82Uȸ60< ,m wH/J+C;\bt`\6C ub"Lp tt #دLJ ];e2!e@%-< ü2OJYWӴü~YvBX'KJp=s(>u`8͘f(E{cWmfAo[cCX5yDĩBwI@0'8U@nҩQ{#e1+ LlH)Ib9wĥ=*$jHJbŮU: )A GG((&1z|ѲD4u5XZ}VdkLNi[Iݨ s\xsoIϩA*Ooغ2L#QD9RZ(KZE[XsXTr)UpK%#`3IL#a6TbX[jf*+ CNKI*r9ܤC ڔyuA3ׁKm:7@ֽ ϯOƜ[0`B}`:´ 9N !IP fQUCTWNJ*"6(q 7l5^y/)\[L$vC2Tݥ}n>^\`=S@>"GPŠsB!N|O^V64ƦK+3$!2#%H r]$rTY1>00 k)2LĸB?4 JM;UX*X*Kp[׬JBSPYh hHw{ сeP(R .#ߡѫ $ETϔ]P ٬;Y Zq=R MǔI Kq!ڥP7M~Po-RJM`cU4F\S"EBBJ ,we6WhTjr -0B `n NǙ8TMJHs+lc+(i%SR."*ΧITw;vd-&5 ‘h+z<ȱ[*tmiڼ{tL4S וqFYKd Z]Af+%GRI*2Z!˞p .\`M0bI'btdrLT/9tFBt VZi #Md;a5|FBI[ǖKCʠWhpx'rB̏#epnR!8p5@p1kBc!!7F_7w11X_TslGsG)3Q؅cM!<}CaEKJzhvz+5m@ %ljqԭoP`p>(q:*P?Ȍ թ|nb\;(RidL!Zt5OrHGgԩu@,-.I] @?R-a`grIȼ&*~=qšq{KfI.=Iw2<t4ꨆDftUάjw[FY"ůh]BT}}!)6^TRls_LLR$:Kb[]IpyG4wS"; 0Mՠu09\VlZbEV@U(eJ7l8QQ*\fMRRKjw; ^D%gZ*b©d1?v[ DڬjWh<-@n@T/xRI%$Σ2c>>Ӕ-9Ƽ%2R T2%!Oee$aβUD5Q9DhI :yMlÖo؛.ӥ ]e]:xRX-Yn .0³i1X~1[T'b*!9Ea.ebEd.zʋlIp \ϼ\cO"~*Nn8pW^#:wH:ȥF6."I]4uj,bkb}Ns,V>rn?&`QJBIinaLM)]?_FaqS5\z֡0W;֠^=g jf/A6.\ʪE@Z ;$Ugm}L`JIYҒ_迱mfmftppEfk֠UEfGud".G("('SB\&  ,tG]+)3#E=G%ӖFUƪQwwh› %7eY1 G5wko Ssu*AW3J:f$F! YEo\$ c}{ŠóBK!d}P`X*6BQ.Gʢ\6L $_M[ *Vxոx$5% vn9r:hIQ5([AET,P$sl@WSVbY@@w7 x)!0=;ֹC,eLj6Π>q\-iRI$wwBo DMf LYY7,H Llԟ8{RCY``ni77&570=--ZR;@:BJ d $zor -ޓ,#7'c}X{c so-%5)aZ6C脓)@hBVbѰGo4<@VHZsH"71ZC90vFGОk|#1͠٣.wMhIfmc|qI/\eh-wR'q\lJl=P;H(/cx-ZL1.:n;a>ڼ,a11 L.C?$aiIY42S9W2RUF<$ЮHdIaʕɜ ײ;eabN5=c%nVz574namimb1g1Lj1%f34e!j[7w(Pu^īF3I0ڌ`ɴ2OhMur2ƪ+)UK#^Q &YZga TJRn|N,6K<{;t8>O.k4WcADw{LFHJl(94zB.5AkҫM5(msI X j@ r˹wgFKdVHrEs K_XE 1rm7W7ݤ ֡ɣ%J.@|UvHL4:N!`03XT9?Tl%"kpE3MCq-J=@|y}i BkmS7V]2lQKF%]aF.-0]X={=ЬNpI?0Ad:Gu8-J.c?bqJP2! )y;Ǜh̓4szjrϊS㧀\*N]H$W9Κ,k2ǀ׽t'0Ӷ|"5d霴Nlj k_IL*1*̠Մ2 33SEz4ٿ^⋜A@|ϽyyQ[o$ |1vs2)DE"Rs e{F\Ba' eh03,/@..eV#% ϜlS@NH;QڕLWg݊MwM(81N`v Gߪ 5'Ea5#cA/1;l(L5]Tpthk II t$^2d2gB7 h&(33 szT vs9:̶e8AB ȠEϯ ^}Fٚ )%ADaЃU}R>`SǦ0|ŝ;,  ]xft E9.Fhݵ1 'H(D-52mh@%1h*1Pe BPjeoEh3FC1h1ׁItr[sJ$jr-팰dl&5v%OhI$^_X  F@ 63 D% .Jcqk!U+.P$XhZ-ڽԔqa$ݻ# c}ƥ:Kynt=6BI` fڛ't@նPc׍ O8TcƪHtEwkcN3,mu[]Эʯ~%&nJD& H-b7uӆWRXXs42VA[Z#h2xܭhb==X8vRy($xv6ITS-9e O`;_TiӶWo㑩dep {3eN<]UѼ9ߐP-a[X?;Q)dJ>9Okc=VkZ$GW.mr>(6ic)qF?;qINI` r%=HE^':L|!+=ZƩ){a_:kCG1<1Ls&{bL=޵# dOgܶ!aA($Oe$aŇA{AfMyw,n,R+=tr2cZCDə>TZR41s-. *:23Y(Oop;EK5Q,"L؆CdV*T9;O~>8:Lq:.dDn@6HA_P<64.u񨬛-&ZI6)s &E*W0Jp,xy2%*@e ݇2[`W%lH$]`pABZUxho)wY-BNs,8@0O Y.ڰ=IITp}A6)YNVdC@9@꾒brongj_fF\;Q z뵗q$Ԧ]lA !51o`))ǖ7fb]SG{7&gRODI!-KBMDs$^ݻ|D5ν"]<׌'r\I\*q~b+Ĵd@gP-sed.,I\Gr"ÕxKXwmZ>TI?JXP7@ s G,ӈ,jd}a. xsqU(7x ,/gB6-\D$4(NHpNS+ P&F$t/В\tvBac,'a=P4i q q6!B\zbP6 )$Z%x`"pcB~JhI2ZHx77*PS5zx0 #a ao4 C75RSL,+]1}#ϮwG2;RRY*eB;}ѳ010JQ.g5xƦ0H3@][q p#a,g;I,2< f4YPĻϔzwFYFmjRZxGg c}#6ۺ5"Vnjx6X<(odhL(/}c7V$j+ kD6M<3MϫYă*B]\JK#'NDgap=|ښx rjb۬Z't橻WZȌiޞ;}l 8 {@(̝7ɹ"ቘHM7^zݹD -?V,)e(QWԳ J4#l1;[.M<(ZKbiv-gC_{Vm3JR;vOp'i[Haln^ɁÄ>4LpT,.n4M]JȤQ&QS4viêVuR, qe&N5Z>d,VZY@puB4 =*ݢ ):T$~ԑ UBYu)DnI%K}2GPj:<k>"C]+JnXᓆl8s2FH 1S-kƇXmy&B|l43zʦ,9kJTҀK\'xܮ/2ƫQ*bDӷszǃgT)M,= H3=ipoZT-K 3Jj{k_*u[1[4zS(@"J(f)} FhIY!r`8≩ET6I%43i3T"tK8ttڮ,s˜4g/rsAy4~i#ra &8Pp)薅 G]D]ȲF0pӔz4 ,#MzUOhG%H\Z[7}V[!@ɬL>$ jBbW,(9 K]J\v*j9q㿖\ABMZd3 d;z JQ((=ƻoeЇ]pcy)K'0$(Ӳ)Ehx|'s:;OЃ0kf ̋S'ޤmFD P`rIwOE0SaIZTH=U[ŇK2q0P;UZ'*RLFoI=F ŭꍝj\P+Sݺ% P#4YK6[QϺZv&9oJJA&шo4 7̧&בX>EYl}ͳ6Bh4ַ(9FfNuu9אl 5jFy5b,k ">F2X7dV|V$JWYcFׅ1QkG&VJPi7}_lNq̓)&Ww4 Ƅ_jA;  s%(  qFքJqu) %8Hm=&VBSsA/3E |o ؈ԨP5[0Vn $Ǎ02O^<2ܾ2+@FDƺFUt1\ o $B|HܵvQQ{A2  (S!+HX kztTY,r\CzJ$xAfwIڅI)!7PbG+FI): 'fa5p@Rݮ]R`t=^NkmrKt&Eӝ:Z#ցBlelOa>UªX!v;h~4F̋Ɋ`2=˭_Z4)iy24[ Ӝ:(BmUd"\$XU#U=fLb<D4 cX%Nx; '3ĕs%KȲ&6G152ȘQU&;:I˫-L- J'`) -j& 3S97jz<;np {Ww!kǒL.%3Ih.Hԝԫ$ 2c>:`{)WkBPАM8Swqr8-eRҫ>[4i;Q3.yd}hZu)|a)s9 5)BPԶcTӺu&w&=]0h4z'P9kw۠N2XְUzb Eå{c+! k0Otkc=%232]WU4@LM3'*tbԲߌO# ,F@ǭjC~SvRkC!`eW:HGths5ԃZ4dcw;q/ ueH_x Ãr- 4Zv$8N3ntdGďRHؘPvÉ2lL":ɦ@3MY|Ԑw]Vu0|gEgv vfJ936 t WFS$$f-#XҞ_JԘSu""O !5[B[#{!ܛS51Z$c}`y!;H~!+12 -'gbshPbr2t !7b kj2Jʕ]ؾ7G$E|Ք[`Xjв%9ĢW?6u `ᅈ_zM^VԀ`Șh8$7E9"" rշmѹM5H#uQFV:WMktnOo YA )HZddQd*ZBI,Y,O1&LudyM⶯&+ZK9'4SRt!VrwN6 Zz `%k{a] vo f DҐL#-e7c(+\ÌXTf6/aFĈTvƤH<z1}cF)P!oT+18X#P(J[Djڕ+9Ty3-erAod_tݕcc nѠ{?1Y EdƋf1<=^֍酐/A68kF#[`.m(eeQc1 ׅ M. (/GbЂi *48qB\+b+Ѹjj<~SQߤ kh*Zb ^:|IB). s`qKKY%=dX-"kY mM*mhaxyd)؇exk mk# beRMD/S,oþx9V+5jRNe(R}hЮ+<_*t@1Q$ܝnD|fޒԭ {!9uDK+W{KXϭ[m gt 'Ku@Iͣ0G#Z[ L%Kz cѡ -S9i)S~,@Hz[e( P*%U&醛\ @S$H k8߈|MoA2Iqp=rJ1r1֭TꖑѐPyD_/d4Kb4*b%̦ ar="+f9XR]*P:7᪬ҳtHVE--2hPy{rV! z*Z䟺NB~PV~ԥ! rX8l=d$ָ̤'Dd%}^ ӑ"Tٺcq2ޒppYBq%%* Lq.8Jvvo,}eLHQ@ݹ:5kma͎^oG$:DpsϐP}NEG۶É$ej*&RkM:֍CD!1F)X1Jg5h{>ԴRYJtB )Ȭć11jsak7NuY$:%JNzPS`o{@D3gG6PsvEHX5sZf퉝a{Gzg|g );#;OT|SjnlfL)űJ\{@x-\a|Mb8C-%:S",rڲJ|A7ػƪչZ5StU)׈3I+u4Ì Ӗٮ{ `._Ԧ1 4I9Qص*[3#ǚ{\tԝ{6&%tƂ`lxȌg?T=1y9CDtQd$3ؖq ps:rKp0 ۡ(KcH\3l-ԉ1LWmJ39ܵ 1)E l{㍮0QiT7"i{ rmH& ԀRsTI,p !P`dbtjZ9̧ %B`#A,b(q˞ebyRӍUۤ2$oH:<8f {]9sDZ&p;ρNZ[OX\\sxEr 1,@Ѓxo1DYҧkxʒ3n ^`t4I4fD˂s#\VKrª<;V( ^ 0”%9vz~WY}=MdE[g3<hpyp\5Pˏ?ZiGHp[JԹ8SMJW5>k~͢1ZtRw{rDЅewvWa:M3]ߨRwH Z ƪ3 p_A9v5@8H+tHJ .Ip],:gܜMK%s$A 7ԶFic2 .=+\$)N/uUY>hft"P}-lK||o ބWGd!,Ƥ[P~p,ݚsbcq '4NRNƸ{nn ;8aܳSBIa992sJ0bQ$r{_=1@l9=fSQ=1̧>xoIAҒ Eּ5h-xa{<)Np |3iTnͣFx~QܵmhKǣ[Vʼnc,-LrX1Jv$==<ZVc1'30#K>ё-oaxٯaG mla%Eu-$yFѪaf[l6Q`!lX I jcX:FAǶ4B+$D/ ǣB 67{-:I"!xJxl.#RzXA6fIvk[52&@[J`ؑ'`|v;G;#0bkgD=5XtviE$!@ "aÓ42ʉ?T,O(jW O<<vSz`~AM|@ 6* Tg-  K.-@qQmC,oTuLbIDDFW=81&DӚGD:oQ {KHDF L+3hQ?gLS8{֋RPԇ?T)MN/,9O0r (k()r%-ʙd*'"7uB n :i$ uMI~H,ր 4 4 峀sj&tPlYu i%,*J<ɆI‰"tMĔkRc2AIp];tQ3U=Fj˂VsU-VfMGR'#*,z6f7#M@ s׽tM`5f6p:0FaS?&טv«3=gCpDeXQdF}&pmϺ"i(&Px6>0OOĔ5'kt }U-D7zON`:ᬯ)2J $KHpsOjB/mP"pȩ{-.WۡJd=+1cn Φ\NRQb|5Z *I֖J>F S̱5g+2̕4RL u(f S*R׆=DϹQ.C 3fzmhcR3za?gnU}uCZ&ʄ]I"ol0:YK2:F sXx8CMzTTHRP\3PE#R)r36P-IV*I dj2bPJY ?)6m-|{ɓ%3D ƅ:LN8 Aa3Ik\QYDfUsȖ&%@JQdĖ/&*h2MURyfqiI $% E!AcEyi֩KH(]WÜCU'L$jRu$$ö۹33X7ŌmgI'թVv9'.ȄM-t(0 W+ѣ25r!#1;cyHJJ:۪ܶ7&VwI9.N p{ spLQJ#۟82# *te'r7RDŅ}NA\a<&%:5MȒ\:X_$6h 3J``;rςecsAB9dI܃c8>'V*4بCذN#pl\D+\%THq'D!J*.C8im|b8IǴg{jViǵWa[I,ߜ`Y>.-~!D-aMLM_X=bw̗fW[R]ۧ84uRnw{i9ei@Gk:Yl-Ԥ?hU$LM#Eɑ.]D2ZB!N񙘜͒X'mLɆ>-(0`6+\a3HT wˊ<7PFA+vMF [>)d;ǝxxeJheL#%H_?Uk#4ԃגj{"̫Y !drZ?ƀN3"B‰)ZÎJNot\imQE F\jNͤTCCIQ q`3<`}p49dcp䰀U-Hish\l"Fp%9sba҉`aA<)Ya̘ϻD9&REʞ3Rr&g*eDŽ807ʹkNrB͠*k*paYK.Ԕ$,#Z9eQzbT\I3Tڽto2{tY<к1N`k\6TA#@-(*Y:z95Rs( $ݛW",-N lh) J[2AH;VH̘SQחuޓIϰ1XI X|Ͽ(ʁ.4,Kl%N'KkvDW 25ĒAϳ>*65Ä-u:*Ne(aDĆ@Ͷ4URW-]"*]K\5*U8, )I&?js6kyrha>_1zpꊰwbib'1}w>RJDm7m.e.M`f]k0uZ7Wnp%8C]1+ye мٵ#oCjo\$a*Far9s==ӕȵǦEnF?fY/Eh1 dI a\]ȧ ?5Ir{yDuv;KLʩrT S8솦t:%դ/,x T4I .rcDwacQSTLK AU Q* PKWK{k}Mx305Z.-44䁬(23FY8)2/T@= )RGKzzIԧ# k $7l8>`:b=`3<{#뫛g;ڟLQreL ~ʓheرQ,=&𪩴p׃F$q Z~ bu][|hTe`0D9(_9wvEoЅgA S BW 49d]|1}w .B֩jlHꠎn]KKjJeB懐[BيC^wFe2;GbiCjjF' JAkHo? QZe'af$œcqDBI JrY.ݭc&5]AMTqKH܇wSҴFs2S>fmi\u 胆|yY )j53PuTU?L1TbҦqZ]::J\whٴ BIkI5ir [ux7W4*R[=YzWwDT& ?ﲤHRFҾi2HS3{lb%G[] qN*IJݮ^ ? * O[xS9Ǎ:jNS}5i|ʣw [XƋb/xigE}0 HI"pʹ'q}CUm6qf.PңQi"OBTI4-\b'p(/2`_щTuՒT\(l9VRgW15D=()P!`~Rܢ]$c2v.ڤrӏbcR ^fдhai)P PCb9 rN IխmaERZ3 !ۭ"xd#DE}IuY}abzfM>xzuT5N`K^m)s>l,G -&'1i$Jb3ɠp19grʎ a\PcJsӼl𝚪:qHƢ?22 h5Ƕ c/ f\nTʐ.IEYX@&\BsM͠$']/8ij+$tTg\!#:ӕK@$&R9|`[+͖CvݴAqfJV..Ԩq&{Zitn{'.y UO%?7ZڨxUx^Jd3<7B i8KjωTa! Zj:j)Te  7\7ͥT\Ğ֕o.G i&pPZj2R+T6ZaRANa RSwKDAn&T)3.Q`€rb"U1S&Mw@ ,:ER+ma^9]UH2mwmNS*de h>9\kKFȅ|uC ~-xp0FYfZ*6q$vH : 1lLI $L@ {C5J%JJH* 7\҃D*EŜ6vڵ rqI*-quLG񈁦 N9r y%qftc>KbW/*VMي5MdI j͚JBA!@m7f*Q$[8ϝ#֠ 16M@(ҡ%J$yh@V`bAvRza r7dr xT2yK6V( $/ X1 EAr ־ľPG_BhkP& ][3|vx5uFSbhHq#BYębbRڨ?(`> NoM CZa>YՐ+KJ{o3)9bOA)/0Md)ޕ1' )d)Dmfwh F_&8U0q̪dwS-J`1&GN8h@/c+})qE}BӭH /ѿGSvRQ0[1|LnbKn*1I'2צѓ^#F'rk*l6c) 3THsleC@.:ư^&IK9H-0]nIS7͓-jm@KX^9PZ uTJ :E.tK%}tKAlLLЀy> uN 1"1r @/QjꜥJ`g^QI>pta-GpY 5jZ5eVr s@ Jäǁ }&`BiB$q%HhHu)D.aNluݸk[DLǩq~b;R1lgg["$A64$ =^-@}_N^:rLzvH6N*nTٛ~-BΥr US0p+SֺPӦCJ K|.$sc%i I(8Ɗ848u-7'˓TՕHv-ɗ.lʩIL Q%5ōZeeCF\VUSvA1 |O3kO#/ڰ^QuCQ pE5<Hi鮌)d[-D"*&JY)>lt.*JsLZ)~s2企*X Pk}rEVUvHN+0zǾ݀TiԅL4';x|67nẜ=[\^H@YA1JnbҲtJq 4g(uf  yE/Ø)&JZ,) 3[)kJKYrLtO!g&$Xez4,:8={ og<R %yMKAQ[vzuux~+Pjq2NmM,T8ũO|Zxi16C\+j:]N‡m97]G}gLUϰ朠)kâ6RAՙVx436{.>6JDM\Z%Z;a@VJ@C@aT$%RO 't+]#:CYR3Lss,t9ML#W٢.*; Aw*/+$<19ԶJѴI *ܸ ~Ne#GzON֓ $-Gj i-x~ P&Z,E%qʛ'1zYY!#)dZﺂGEM7N1ir9a1 xm:ہٺۧSUk\[g~Oz G~e7NaJI}K>覕4ԣU%Su(Oqy;~@= P2ʛD /X Y=ٔe+)Ix3kj )5 sV,Ov)'pӸ}F-gn}q`Ϋ(l):zBPRt/ b=X Y@mEAy (%JVg徑)Suuȩ?.bpQ-\s_J \J' .ϰ)O5R-Pіy+w'^q/"X_XKjp)Mj X5lFzE9QUr}Z&J7{ti.~NG8QD|֫T7TN'IO-Ijv⛇& ]*,aQ_KZS*Y.J4$hS53kxR{8d7 yFb1`X\ff`|12A()$NVO_>%K8THk;=6ʴ)߹1De0s$A#rМ첥-j)&(5WFE~zyCyS)2I1 A)̢űU:q  4WK*|ba%֜*skE6si\C$% %Z^i$Q6,,454K`pW!h8mvC[)*kkJM8s.3'\}_ծD@ ]'UB5f Ca˒%d( 8V,(y)"5ZP2$0R >pQa};bb_svxHp2E]=sOBLU1SLmpwXr&dx'jxWrfmM!9Ow5#!hdem[߿De6c xi''M 3nҤ~vK$sxU2˦i~Ĕ ܫ&#O÷89ǝJ,"[ fR#no=W;23ЧU2sdU~-dSQmWiik" s^kȭBB쫆w\F^܊Zʏ2wI|tŠuH*\h90WU^4ý"&% S@(3ۭdJf2$RlGT^QSH?U*|ڨeFÀs  TC`CaVV0Ϣ>Jzގ:vG6 p"c9NRF NTRj̕ nXXG).qKHWQ%2k?9Bo;) \A>j}aw@6ҩqXCkڴZ;a6؆\ac!bADPX;rXsjUnP=TCXQ vZ6K9q/z<*09b"vM*`?G&$z18F+W&`#,1!lT{lE[E_ q1heꖱJ)~F+7 f#.M^yj=XfZmNaUOGPؚ]J9NҥU*C1-*)jf˨Ff:D^Ƹ?Brҝ3-b==)SO ZWI0Ç'' wKJ)!L74\cL wTi19 FvsߚlGh4SerWeF#Ei팉iW7튚BeJ,RK^̦he&r2,5}C^Tx_u 䩺˖iKa<DUĎ@,ZʬN~DGfݪuyÇTN0<:9ef) BU5|ItrA0j uC;8b=Vj)ROFJ1%@:FT*iP$sW?D&''ڙ!y8yE €=$ڳ"y 43ͥy[]nq ]L^9'RHo06{Lq!|!9:AR]lI)t"ݏg.PҒl3>qma$sXs9јA`˰D398 P*NoHv l?-ATl^Zfp̵\l]&9z;[bnyLfr $jF|JOCoBupݯ&ߕ* ɻ*ed//ޗf+ zSHe:?j W2P^KGD/&a?+.cGjtIlU)!{ v}˰x%M=6GtߩYVPǪ2s}O px|e* ]#tJh}X uT>##q^4&Sɶ8v4 ir[U)s^ sRmpRۘeDŕ;U"yΩppU~A%8xQϘ]Y OaJM] D B-*S5GK$,T-4Q:%QJI-x c&zA NlmN==Mj7MO55U-]B'!c$3ᘦ6YpgLMo,n0څA.?;kPZ48ô'LeZ;kZ79@ Ҏ`REL4(uHbzb<;RԔڸ-<'7J()$̙}6b/BNq/.~1,>qK=b 1k[B]`Z̐*aR҂ꤒA c{:zҞ%E\`V/sn@11a"7XHrQp}4|CO1 Mt >/'RV,Ic\ poHUd4=iRYE@W=1DoF,lq!]7Q I'@dZ/]IqHm۽" qh5r#XpEB2M6&e2R-Zԑ& &\NB)@uk!)Bt@+.]:'j[$F>PN j)1*A*HWXʗ'd$Ds 0}(gFAp4+v4yԴtGO=FCU1☐;[1 $8X֕_N(ҝ%Ga SU}A2׳ 3I,PvqrӪ*Sǿ723=2V2G|b6rÔ4iI>!5z::eZ Snc S%ZhIX \N2C]#;jPE@㒋}mN)׷H*3u\}fRVUr@SgcT%SсIWnf%h iy%G\}`O±ʔLsOŢXVDhAqRS:ZUސ\Zm6| 8bhnFk b4Yɸ ̕?*ʟFI'2xrF3)KsL:` 5gȸӨd(`0ݣH$W.{1Tq鼹8ҺjI)TA)r9=!6mU4Q\YO.#08ݓ) Ri e) ۥYQ^YZ݋vn2ֳpM7 2=*W -2k՘lplhWi\ת%;eq@Rc*u7 hCxiQ/* tze`ulRS䒵h3K,7F%_9,p |r U2&ژLk/ɋ6_")Zč1nÐm/̔[_` :H^") Ʉ3B]^H Fy9G8MW El4rSPj`IeR\.u7h"F+pd ϗ0UkL[w֏x2c0Z*peݑU:W.:椶nu:CP9s!jRԩ3I,rS䦖lTo`%rvpu8^tiQ 3ĥZC*f\ * oy@4u3y,'A!1{jS;0G|xDJP"bCNw7~7,Qnp ؾo8u5]&Hr].|Ty22ӂm9:> Fu I׵f%YNR^4S2Arn#PeIv:xƎU?u1,ysXY;.JRᬚ7Cym{_O,``pTZxz͐9[pyFkELYb\>1 B&Rj*LԤ(Sw5Heҫ,J|_1lHgMEbx-7IHb+|`bϢFfDZKwG sam(ݬ;O NUepE|kI+ Q=$N_܂8`v<'K#*%@s 4x elD@`|ēy+Rf%ju%'kI@;LLsP9 BzIL/LTTJ.~.$Y6!(KgCN'd8O]\ *)̸NWTYxm3=rsnoL 2Okܯ q! 򔬡$]1FbmCu]!Wԃo8Yb_BAcz °Tmh@4܈j@VwǦm|'vx5ƢSf^؀GhxNotn]h0MI5TRzxĚuq lE"KI'W|ފ4XÛI2;^UB< UZXqLɓ0L̰|# o_Ht/2@.I߶ =M"j5H/MM5ͩ@1)9A*AIFI;GRbɃyIXSPwOg0`;qLZnĉ QG}LcފjU2)W):7S !C {yACud<_+W6ʌ$^{wqM-fJ-LIS(bbŽ OT9@QrO8Zj_K8%;Cܘ;@poU1t(hv_%-qz,.f7 wC2B?ڪ1ZL;t"2IΒkl\>T±9u((t$Ot@zcHJD?dWޒ8:)$˥S*Z w1} [8,tvovtbUhhثF`>[ ҩR~FѮeA6s{=-M]$ЊkbX)$Y;AG zEF$th.Pe+8W OVzʘas#3>I$<]S1&a."XƑr JBr $N$xtjv-!Nmx5v0lo<ߔ9C\yHmRHh3A8+DBn(t>8) !+BǀcYiMOLTĭIm cя8#lcu1rTf5k]1ȃT ")Sm+4%ցr3io8}{0J:WJ2ʔpG>qjeGeeU*"F{QK+䌥`$Ods?K.B%$ kXlӊ&| 5dg[r1Ν7QϷKe*IvI-Ԏ˵r{zeܺ0IϐSjba؜%YgNţJ2_eQ'0l(p0-Y%TKL[*&8pyrfM7|vgXBjD!`)'bi gr`9+3K[1\Nme1${ClK-g*f)'#"\e3jSq+zID&|#7UYsHq92Q{ !icM-"A)u62NƑ20 _xi5r å 1]HDJ!@({[jI\:)5+]ElS +`ASuZ=$P°naޓ4~o3AWs԰l"{>pJqO.J\a f!#vʼn+Bݧ*$0i6u7s]c#:uev  _\j1%ٗVa!h mbڍ tYC9 4 E}+?+.~y\@ Vqyv@a+};KݡD>Jd56H3̙*,nѻR[72Nd B#o %#vT N$2$VcRWX$܄ỊfbJ[4tsU5R?.Rf)iTs($)$A.;q.DJggZ'YSRzf`B[kR-lT#ڤ Í&Sy%ĴKI kK= M0FvҢ)]Wx? $SZWm:rعUD4ؔLV4N Eh9T1))@UL9iZRJAH ےÚcbL=׎VY{ZCuty 9Ew IeSO(if 5*R)5u~&N}30frH~rLܻ#j2[`t0.3_,<d F[\Z57$I[ߕhm9Ʊj&< 38qEeBϗ6se 0"*/uux֦Zegb; znŠ9 zޝkjb#xr)/UwKU͹ * Fr(UD9rQ2oHNIFS C9IUUt?hȘ 9DCNc(M%:5a Ԗ02rë9ioB#V.:f.n[,MmGn>+gfi=#`xÐ "֍ SH*IpA Y# E jk>Y7a'h͛!}'ꘖzy5kiݴo03ڠ/;*›:\VxP E >fT$Pew}qrq?4t4x\ĩ&T!/ ũUQ._4dx_U4IrtCFPA=R5zj.DHf {YVvLvJê]yaHKzѧUvGmjnVCGnx ;GMPcU|ꥭí@#}\wJ"NDH\(YbU \I茩bhr  BN+0SG=ST FY'7fj? u9ePG t@1lDot&W\.̊jR @bJjԗ/s(Ӷ.0G}RiWHu>0 LN]qzU> wIAƬA WJ]&I"JPε9lRם-H" 50{[t Tm{JfJ@tQ5ajbƤeotursqhlCQSTd4'R.bEWOj'-}VRTK(8p?Y:" c6Kә] 66ꀵj?l.Nx^'|ħWLD3LAEJ&>iq7FFGf+59R YQL2?fzI7P0@$Ыp7tc?r1뎟 ;FM˨^1Lr~S5J3Q.RSHG%SMYLm'Ek'[V=bw$҇{^i GEKFWDtx&2h?HS(ϟ9}gJp \\̴JZF*T 2&y9I큮Lr óJ-l-rO!_q/f5 w HR!(8 Doch<# ls]XlSap$ð8hp`ȑ*èhq"d`2.&TԺNaIK!+M\.~QEyVT׬;͢:6pPXMZ|v7:'5>FU/ML2`?`<0t2HK%g-z$J ى8 -=IUAE1'*GsLJ奌ҸJCKG{*Sf^doPSNٌ?«T n'%9%LcL @ϴ+`QPst BPXifC 0 ؜٪6"a$ݺB+I3f̙ZoP7Vј AٻFA*i"kWq3j].5rKXuTTŞ%*,<]|?8n DjbXE'蠶M#u,e MHHo(e`jS7âNȪ5m2ʄ UMQ̬ 8:Э&"Kz(Dq I*THī*)dT)H)2xOF9pVOVv `nAhҢڮؓ##8 Uh/7?) g?)Okt$oT'S&)Y*%ԡRCʚyv!!oS~g8-$^VLǷl,gLJa|}7L:v 0"&Y:=L.IRs(_QHKpj\~BiR19K)6*Yڎ`EW%T2S1a B%=aa[Ak /cit\d302P*oVY9G #a`gT@E1YGIJWJVc͝NL*lʄ %`'*rKܳM\.sNH 6ݰ']WVaO䶛CN{yʵEw9@ 3VoF;$O*bp w[S'dP0X)FB$E,,*I)iQv|3]b#蔄2@K{9חFL{|J1=`y;oZd %s>0](ԝ3q eyB)!+ kdy~f(p j^:*L>\R1Op-0\$XX6{EF7ݦpIDZ*^sI۱qU*UZ $嬮xHw7CfESVN'4k!vrh_p(ʜ3рfm񩣗&ja ({CE${fбhsZ؁!&InnN 4꺑0@)&nK :e,1G*V3O#1!92ĕ~8P#*$T$(VRCkS9heA2bTO,1۟|r8NRv; &!#~4I v?T(isޢ =^2` H HHmoڼ JK+v#F,ϴXuTQ5-bkR{9p?ΓCIaKnLӜbW,F+ך pv!*dePqVćESԜ)$1 aeG4QrpO'#Xk\+")Rã8f5h)bMT!%]T -1Lz9䞗ƮC){-%M/ iRTN0JINTmQZ%0 vYj\9TOS9u7#s[hS1,G#]U/¤q8{:q,"f6Xi5Ё8trܻ4XoH\ܖdhjEkk53l #NtGw5Qaa0 7*Fe$ 7nRAvԼPRKC  ݃GXk<ˆކ:n=Țb)9Z넀Ȕs?VL%ֿdQ8+MK40u's Mg:9Iam*tj/usZ3l2),$M`kGTI%$ј *&i+088%2HA2L2’e'*wakUI>rDܡ,3%WF]ciU5Øi$7԰bW3"t:rE_,Z{9(mf@ii4EkXBQ/ ^bЦR+-Uѩd!t|̘;CΗ42p$}(q 6Jr&ȵ2p{|N۴yўK[RͬZdH QƴqZwG.@ iP3 79"ǸEaGE2uda1jP`ОgM/)Ny',P*R{ q^]N"2XII`PHyEa38YH2Vj-xmV!vu[:fD3]1 ĩUk PoB.ě&)+89N[u:0*ISʦg$`껰 a a5Rd̖II%=.b5dITj{UGY>T)k$# =(Stx'G "g<ůp ur: ~LY[ko:#/bۤV_<N'x^-_L2">Kl9.[ejlikp8:pZr2ǵDAQ  _S)j{Lʄ&]v υڏ\JJ lmĽ$X]\9fdSֱ.D6 Ud-$Kߔz744w\22H׎Jy80ҝ&Skc]Rׄun?ãVg|sai'W%W:^貳if(0=qJHJT%)K(W\6L R.G6qg[c_|t!oI|X[7}eF4%`7kA3\ػv70 ƞW'W3j2V~\g2V7I/䲑6dĩ}.9YB֊yeTI!ȓqjZQE=P 6m :NUfy+kAkӷY8j`Ie'KZ;!ytQwnq0ր?H\'b6jU%+471*j#J-2 M;* m4)PUi2`ѩtӧ@)'a5z*s&W! lc%NTs!&o՚\k `nm^8~V %!@'*J%.tT먘R)z!!üGItҔIXW)-Tm([Գ@9ϒN%0i l%ӣƎ"kA}#XRpJ,!Ÿ?rgfZ6S ˈ,.g,`#=MjF^D*I atkZF9B$-`ٻ%G3h"jIAvQOOGS4BrfS^'55Q9(,+7Vdn V0RǢI:9vW0rKm@,DLԂvݭw/@RP¢a,|o֣N\%`SFdKJ5!$+Rmɬci5 AQ6f0R^ZSˋ~"S'N*Aa} d!*P P C,kBj5p7贖s*1'fNzW)6WI\2[)xڒJX\Ștur%"ZҩK!d닣l>|L 3 p} b$Hܧ0D}}9"*,Lnޫ@+Lotӣ#xaɔQYôMI ޸A8E<-"zΑn؜3\:gr>&I9=ke%ʭ3\nH]-5$Ma.X&m5 *4*+ Ac숔b F !RtɈY/dfnd*9eVA) _9=v(JFǴ=C7U5-gآ D^hgcU$}R|+6t&18D$D%~uHYwi@sBO9)Ih]bns&ؤﮍ:jr̡7ttWJB 7yL,%}Ր>%6NS ܘ=ը^y5nS|h*Y'0#!dE@.Jѥ0I"j))0 I6mb4 $u=r Bw*y?t{ #Fe8M A5ӧr=Is69;h|߼$$RI 9v=?Ѱyy$Iaڥu.2:=SțRQdmb},$PK5h؉XLdVQ)K$FS ̦28x9 /*1)ـS3LnWMH#kijdW7jhȆs톳u{K?L.r9qp~ܡ$%$Hݡ^x# {㨄f6_[Ǧf6_[=Su) ctT.xMXԶMfgte4ORi) Nm[GhAA>pY5J0U9r/ĜRRf#YbU)4i$'ݷеu3H#tSv>Ɩdi*wSy庒if!hQŧ[5("`g*)1U';9JBK K[^LjS2rr}͢%8_թN,nP' (Sc8'C2M.#oT;uaP+er"mG%AV2.gXe-n2T̨O[(ԂĈ485sQ&\!Y uX:kH '";l"tH#?H6V9c%:.8rho'J͔(}QATʓ%s%*b-A2$Q$e Q3dPzI6Zxa.JLsÀ`)nZ9|C|H@bF2EApBrݢy K9 m+\Vmv{.*u* $Q XĩӺZUԀMmwxG'Tb4͘㡪q:mlʉfTRV a./JE J=.qkZT+ ȓ:&Ӛ@<:e]:C+SMQUq%VҕHVt`_TAhH%ܖ_㗘t7tN,v5T#: Ymls`-Uŧ*\ªuIQ!1n /#"TdfIVe} w0>{?$+EYp},l-lho[ԹSeiimZ}Ele&;)m&>mIjd/3n]˘^%]D9$+OT=bu8J2HܺRLW ^VNsT6< LT)}gCowc\-ËJm ?Tx5֞Rnf'Bv~]܀U*Af;Q(7WOE2U,@L%$!$嶤UWueHRfZslC> X&*Q@Můx'nj5RS*^rUVmmhU1&@N2­^-)s ŭ GI2,ݱ,(v԰Y7 Ret45 (E:ٝKøEtu58NZr%I[~\S_YP'CBd_,DGg-W`p.&*R!U\#l)apsIpA32i]h5B6-FKOq"7É0&^Ld ~i*vLkYt$ HUxŸ^\*.nO:VdTMZ`Y+"rŮS'tS3UCnvI6fsV[saU7KX`c+ a'Es&KP,F1$)!ߜSU`k@WRdۼř8]ZR'Su$e $h4fv3'R~ |xLJ͛G*b6rI ,r60vxml2KiT#JcT*cj8KCv_F*huFD! uQ4oJE}qDƱgE_*pZP]Wऑ lMJO;r4Lpv)imLTo$Cc?02^$G 3ygRJK*Jb F`|tmX +/ x+0HNfRTRʹI|E_9fX%)H;\m[i.9jo8:=BS}\P8ș+cPHY`AFIBTxs]o|>J9Y0!'/[4R|YB~p}Lꮪgvb {XWMH, ;¦DWKiXMB 2)6!I$Nب50ˬhT@c-k1 Q,T*xK+)~:. 8HS:\!6IQ_p.={ 6.NsA P\py8ƽ-"k[8}L*S,(AMAEKmkit59ЩKP!{♈Y 2}MiX7#!d _ؖVu,+9w0sX8a!oyN{hX~ȳ*ܐ]: ҵk*]$(lp:Xm\"Us767bi8=|Ww5!SVTkǦ h+AU׶y1yGu aJytwN]@#" -lٔ3CuZݱYK֒LX:<[]QYYe] X@H]Ţw/tѡvTi+?mV7D8#BWJ58sY ":/TMgPknBcr"uL& J))*F'.SPӒnK[)PX[Yxbt W=vZqЃˌi⠯+jI痽y*R1Rw櫶5QI,v6bWRК)Oͫv;EcN)Ue)9`)HJSh@:iaۑO0^K Xs䤺:{ńNVXsaTRhPXט&845%Ps%qfUwiCoR2CHfUqKG0s%5kzĞR . b+D,%͔Rw%)IIֺҠx]S11Ӝ/8,9NQt %L6,Ru)Z~j*~aRT9f='G]6YHSeAO^ ;r#.YZY[*9"V #=3X&$t3?>zIZ& K,$L.!)Ԕ i? ƒ~Pw>@&i&{FfiCa4QYl,{N˕xmOҬJrbGxANZ28&W sRDH`ǵ`5$hMs)*Ad?,``9ܡKY^OބCM#wU+1@#Kq.\{DkUU2r,}$mm/ J3{ &aq->B܂Һ4H,F/+{4ݶ0RkEǶK[Z:}kI7?Z&ä1<IUrPXs!dqÚ `GSY}̐,H3Ҹ奠9$hUGb-kݔƄqUMYvn 8^=suZNp:W@~F,̥;:U%UH r"ILV%lXƘRK* ;1øn9HJ:%B`A=0]H|*.Pm wn9URj9êaug$3XM<ą_QoeVLZj%lD[PuHUVEK~p$Ϧ XL X"1,3.|@{ 5)Zй*nI1JhʔQ˹E_?cM2 IMM]Su :̭Q"jI-;!yG-ьB~Y.ZI2C"sOUKu*TҁjH.;D J1,> 00NTTf˕$0`H$b1i~Me0YLDv&5c):b|\yOme:|x.מS^*% I'.3Z0B/am\LRTT |JU9:VkK:C2vuC~ERU(ZXKzIsvM3d#6YyH7$p2+]ڠڜ\ ڏnzk{L5-ɪ˵%ȸDeP},0Cr񪙘5Wq,j X.ò = ⸥LI LxOKѪrC5eLlz:LgkiI}H%ŻmmkH҈'%tK1 U,.]iu!aU$-hRf!C)9珛$r8VpϤsNōjs[ 8 Uzc 2qW0xD9Sɦ.\ɊJl2]0w͓)fiTNmE<:hhI;:%E$%F-RMT+EOG.=Ub{OA:|:(f#Qͥ1amiYkY8=a5+=тCr$Gb3Bhg)!.nGF~pgU7I6TD*h4G5XNet :qe`+&T r(=gǯSm=Te ZuZsTp;r-wOf)C)hd9|>)YԥeVjE7=5քRXR'j_wx>2\Ơ^bʚH'Ϭ]&ϛLJ4ɢ[J@ Sx^\jx`)ťKSlIѠqq:S6Ӊ= >eyI8yG<41:\*OMU3"I H G`!uNJA*#e2^q*NBT:"Jహs\<܈p"E[}8fLj,i EL#wJL7yA`ptΙ',S%O(S* G8S)JC?IhPS镙^_~zg(/%'+}qu®uQv@>kMb抏ȵIpL/1*;;DQke3H`82Ɇ曵&h.JrIstiRPR0 \nʌ(&=BzN*Ju Vfv.e#uH<ܷyC\Ac5-1$#,w02wvptygtXƢ.+AWЂTo$#)lE: 5a_BmPurȝyWvПD$*+ըj<n1mLSڤs$i2sָXd߯_{ė'K-AC_N酬9 @Wl02AUpn4c 1 conܦea%z2è.9y) }Ҹ>//薬V4qó%ĸ¨Y&K `*30ZHR" N73SKJG_sB }=9&]hb]$OjMƛ·v,~QZ6T$X(NloMT~;}. hBҞyzD$Bق/G7UUaɁ&9r+؜GbwkF_ӤVp4TbMhvYŎP\9re +*bN.CuSd`ZR˜2Q'2Ubǰ .:s~s@ EXk ;ֺSh5Xat9]v-=XZ=#kQN^ bݝat؃"b.J5$%@EbԜFI2㚒 ۱p}"rN ݯGؑR9B2iLOlOK^"gTş&wy M 7-R{ښ\ (j 15 ekIMu;3@&X.P}}ë/wRR"#U) !e;0sBcS\4x O AյB^kBs3Jd-mjcкTXynr{[ j KX>,,9h!A-$ WܓknP( xq%Bl s\@,4z&`M$8s0Y j\mht/b ϊB2Zǣw#S83_XճhSЇM]gMݔzs ﶐qQ ɅckYk#,7%A Ll!鶧byvCYu1$+<ߺR{o9^ !a0Jru2C!~gdbbMgzbMgشL,Z hDZ.UF$r#J F˥jV3LQ,/qcS ƪvb/2@9,`^dF |K97 R~-4Nsҗd#,c;{d$P Y FH1h*V%ovsJ KF6be5{.u fA0 7Vjsc더C(;Clf}qQy Nw*=8esAG"MBr̖RBB'MO)y>ndhh#VnU :W6<~ (Bܖo;̧!+tFǺOl H3h(9EK١M"^b6W"L~!F^Կ՞\jJJCXBтIk8+k)e$-axU:ih RӢG3ݽD..w$9$> d֦i2a)c`̤ҩ;JSe $’GQsHnB&sbXfba^l']9XsڇDcS5j _Lo {\]>u1nQi9yh}4qU^I# t*+T٠:4(l+ gdFrZ~Zܼ;vV@IN@QIp5w2*Lfaw$W%YWRR'e<aʚ Jix!2%9o/|d:(TnLEKIM"dTV^K]b)RoҪ}0'@ r:@K}(@[b=-='2~iYa E\)$+Cҗ-&}\5J@٩0;zE ZhK5U&b՘ch;øE]ML)LrJ@x~D!@3) ;J^]S˟'ԉ}:q`喪Ŭ3}#!ZiBR%?)#; Hr+Od3Z.| I1OHp.xQ Ln!3c8.k7> zZr )]^w~BQbJBY6B̔Y]1$(eʐv$TNRfS^&UAM1?qϘxV3JRX 3lMW!2l*`RbI*D3U* k!+_T{r̒t:Ut``¹.i P5ܚKں>()*'{ nlZ"K+(xҹsfJKBTޚW|f~an~i]8|wQq\XNI)Ko-H]%;!S>Fiva= ϱx uZ2ӑC8f*3# zӉpϏX푌vϽ儯"p<;6%"]"^ e+EJBEJ-!SLz3Na'"z%vbUi016pc3?2W]s8NK_`q:'qG mp:,Yd$lm]'$i_MFr\ȺH?I53,J_6KNA%Klc_$4tYS&J?8%@A#Cڞ`7 ̂=R6T^dNa]M%'C"Vʬ6kv>W )b BNN2jk%otMXL*7ѽ=GJLTP߸Ux cjA7%J!.vsZN-ے;c8>XkkAq@#iZ"scO 8Lȍ#x:,FRLh/~Gq㞏ST)rhr)9iT.J{/>GS״8hh% < {yH[v' b~ Tko*MsJ$.ZOJܢU$S9h8_ƘW W:lCbZƃAّwLeW'-`.}!*׌Į[;.}ҔPw )~M߫O*f%u}4:wR\lR|e {8eͻzgRsXoȅ1-f>0@9Cj)N!ũ4uTIU*h:Kʧ!"BjO`1a 4RjeyDTT+#`BMIihA9s2b^a {*Τ7-oRC@ڑႶ)'MU(3\ rhkjS&|е9v0˨m"o[IWʦ"u2 ($6o TJLcv` )# JL8ʒ4ذfLoH׸>]ăg3N.i64?xRX5saRS>pUL 'f VG,T..+萉sTL*3/1 ĸ~BfST{s~F1]4ef9MKI1yA~%ˮRz^/Y`)VD/s B o['RK-isK*LsQ*@cAӦ2]+k}J漒 nO'C1*QC#{ԔbjeV&LP.pHBZ ؖ0|!)&kh|JvxG+~L'tJsBlRlTub%a *ɲzt0 gq]n4ے֔^TeJM9892>mw=&K&9V,vʽ#F{Nt:'"L-E.tө.4>")4čI LXH*gJRY RG\,ߑpQ|2GQJII&ݡ?ǰWTsufS3$p,^)TXL9GMaՙ"G $,kgQyaTf߲m;3>wx^Qg{bZPRs >êP3&XS=8J(8ʩ4apQ7%*\\yA_g6qNN*㍮tAPi<(g+ ѽh uVCiկ9Wto6TԄd߰i-Dr-]8 |720B,Ŀq1]DʜĒ{R 1*Uj9H8"GAop-OSs<W:Xcx0HFkPt"*3)IH1I`t2pS)r(QUQ(!9\vD]x0"?q't89~;Uִ;8圍g679Neo`.|FN F'x0rK`$QI~eT7"y4hkkP6*@wj9.Ǩ=44W-dg/w1@102xQ$--yJIS!Z~]Q~@x{kw-?z ,L/B kA}XaOL*٬,S SѦp[n50V"ndk#^AO!$1mƸd|*[X8n$+m3tq2rє 3=֧: %ctVrqzE$MSjٜ?hWT{mvcͨC2x@H~Zn VſIˈJ8}+B%g. trT*t u{č08P\$& !h9VP6-hq擄gaa&}2~^E;A$XGmp4˄jce)R8[MxTT/~,1)fKGlOd<?$*I.Ols1jr&qI<Ğ).:QGT%`_r7c>p=̈́La)TZnd#I4F?8b"ʘUZ9>*w'KX8 l}Q,br䨿b}U:M}'2'2%U* SPQvCQpɑ11I(I{|+L@83iU*rҕK2EWiU :\($r1AS2RPGL|ssY\J_I)! :wOsLq@gO 7pm {Rԩ=4?yÅ%{3]!tS;N\r^,^fZxZ[XL3־m!dC9juM>?X,Z9CnRcTt7an5tn+K+$ \6;/\şmy7(},anF+V@qxFo%D} >t.G:RO0T{r؇hoh9EڧWqrKˏB %~h 7caMs׺$Jt$9Ll!@_B w!_q&3ySXhaaXRhO~.O~x<5< Fo&{GFU|4O=GS3WEϐg&ڇ#ЦG7z]id%$$@#"L.zfB[^.mߵ;QP itxڇ^Yk`k:G(͠y0ӦL'Òj)THaTzɸE¾g ҉aKO+j 7!3+ BERT% ?D"_aay>.˩),4¼%5K:QLȗC.DIy`KT;*!eM̓`R?~NzLQk41;X#'$lNSbyO%v."K}b#JBet0KGy3)) ?I8R&(@.9h0 eIIR: ֓ Nut`FV_`˚+2 ]eŅHp-AU[+]{:qQ [;_ARIvsoxn&&RD 8N$X) Tʤb;}OG=Agz@ ^ka{DV;7הj3ըCH@v#qcu yi?TPm[%. &Tz"AVTl^h&LSfd2}O * ;zyEAT촰Վa 0n+ $ȝ9)oXӮ]+7A#XjTHb+E'蒰aiRMXfryI9(3VTNbąK$˺C5ct\WE Tɋ)Jr[p6{7PW6ii9Pj> J>xprwMYel BK(PC*PRHkyAO TQȩBT9k\@oU<6l??cCjD|["Z1I(07LJ1xyQ8I.\1{jh=Cڨ[{h oݩcSwyǶI%wuRϭZ6]Z=j}kvCh c]-E G0z|b8;IEFHJ8$}ظEե@NIQQNf24d%6= I¤bb}2GINBsw͘v$ũa_%41̇+%bH:֣z6[L9JԺy?~P˻9St.]Tc٘M3^JVkN:vd8[%08hxTٵs󌋫ZAWU$: 8]QI`"b؛\Bĺ,2lΨ2L)KGBeKH& !W6kC=ַt4~)*kA ` ,ZW*zB_4*/Ao}71*uU("Q epBa<ԕ,eyj!D(1ص8W!I0,[*Y5R̹hAW.i!+&`:–mOO$ݕn ;[:QүD2Z3p2UART>rEJ ;r-*h0d+}7~ ~BIG"ɜsK vt)XL7Z$8cqhHH HE䶞*{EzY+tZh$B)?\| X"fVU1 tju%M>%o<։+} v\ N[o""CQOpMi:LܼRǪ LFo6"\F,3'W*)ЩZ$А].cMɘRRT?(n}L'ISʭeFLdd{u5uH-!&ER!u`"LAII1KRDTD0bSюt}e)6'5oCh&Y΅,k𾚁 B)rP3gE 2u$HPv苦"ݖBXVm/Vale)zS+1`N3r%7H~z lOwiݟ:2I8]6:@2t:DGKX1?dl,$K-G3`ⰔHahUZYh?1&FѶN0 Ʈ0J q$HSTbϤa>*BrXTj.R f"q ҳiv#E<-0}Cc"=ݑ[ Y͉g+Vj|r`!(ס 8,ZD-(c>ǛA`Ԉ%jOyF`T0fT8'嚭23. †.nZ_"cVL #N#tK FESK1ʼnmbY8N]U:-R$$ QVK@~2*zmqk<֒KGrմJ&Z ɚ&,eR~Iv-%2p)4RD@OTũG.&)Y< %<ҔtbIbJ7~k*GFyXMRb5iNTiQkg,FV^sd9C$W\T%_A2lN'>C+!͘$3󸱁bWʱڣ(JXbJjJiI@Ro8L2N˵pe@Z$$Dڪi_F[CILKD[$ji5$,m!kRJ¬E;:^ mf'/I2'U8<oUr@0q^UKH IЍ/IFľ>UBџ2\ztPq9,Lqia=Nٷ5 zN"@oq'=I9yXmFбHs1fP)boW8w&j&)'PwT' ȹ *#%b1M]OzJEK\ʐ7'۬mbZ4Z r1I )%A!JP=Jŋل`Fl5{]#c4Ґ+ё( Q0X7cL&:PhFȄcc}>ci2)Q* vd&*bI# J{-C_ln]2Z G p% L>9@ۥW&n;R}rxPZw> Ŝ{~f"dĊd`8djtbS0gqK/BZϟQ%qZ9Hj JT'P/jgHr *BuXZ.ոcb֚`iUէo8;GW,ejlpr "`=ۜd#pym/jI7^&r$$Yr,øeORSN FU1,]qrVyk!TaAA6u\ P(3u=s؍7P Hjn nornj 쒍.9m6WVz9G ;?{dSU{!܎*&Ml-v r _EjsOϙIoP]J3U5%; |:Q'nG$RT4n '!;][P ,9Uuc &BFLW1(\9u?$MDjg4P;?`kHlTx 炪m19ƩDBxg5 Jg`ԫoCe> l*Zʦ%J8&c* E9Y@mzT[\pcwKQ“99n͢ʖlFeN7, J ;ɤR!V 76hRLU2g!SRRfQZҡe$cg?H4؎cN֠ԅ q,Ys$K:[R`#2"(OyYtSsbO~o: i2y;~Hږ} 3k١/IFv&BQ&ZL;@mI(pJ93d9.P:˲9Frs*mJ;D:~^0Kj\ C̕SfJ& @ۈ%MTlF8J5TU2eWEJ*a W<"U )k\((u[W&,:|k+Nzpkt9MZ\iܱCgAЦјuRJR/Bq:.fORwkhPdIwsB %Şckg<¢g{rf5R%='dZcQ>Ԃ0GMݒ8jRl ?:[ krKy4/W-C-aHX((ث2 fIwHCS*gs\@'/u 9ӦچZ{4<ěC ev.- !3ܰnbBzJA^ a5)T3u#^L6գzyCã7A;(+vrDvyJe6dlxO 2tIJB4NIQU}q(,%=T{S)jӄ .P#2bAK+'1D8$w!jtӧr<~)Z8AwC)%9xE􎀍;}Kd01meUDɊTz*%ܞ]@QʥrotmeT*Z%;HzN=a/|u@PkYw;V8GHG)Jf@4eBHQ,( &&6M2]3Tsv١ ϖːyUP|rV4,-A"{A{߼Rj%{1-FT|XBV OXZ&mn 7L'$F<(pI*%$N9^Mh;*j)>gRY!@SB*tW*Ek YRկJ`VuEct\7wC^cuI,LGjFr)jX\ܶf%!ak E{80`3I7xTE@zSSɓL*fBS॓)J9R] Cpn`9fJgdh&MC0RA)maT#M2yST乺EI$s"5Y squXm@$D8Y(b_H]*  \srvt-iO.3:Xvp ܤ0¶ F$yc,_Xy1Z2}@$,X kWI1jܩD&GUA*о>ἣ.y3vù*8s{bLǡ IbNpߦAC!@%'2a-HJ$0} _\:6?7wT+2v^ .r&L:Bl"GTXreXu#):71h<PյvOyt&8kpE";QcVxhh+@p4!r?=34J)6!,riP4%0Jxf JR7\Fxo &2)z%>L'3N2{OtPl<7T~\4S<g7to*Ѣ4E"GUz5/iyt^\Gf-ZJg NRARw#aL97pnEQVE:(tAIײVI$M =Ju/Gd {,0grMk&xx")ܽ8)k\T}7txL <Tu 2$IQ2!6%c Rq~Th[,idbst"dʌ*rSsX1GH"]Z:@b쀏-‹@ʭ{bJni:HmҥR: erm)g=H[|Ga1տƒ IϘ.p6i̙XA!YV ʹE2XZ+,:(90 x-4+,-*V6`xAI{A_D>mB0;\m.j6˜ c5.g:DW&jVxTC*:_E2Js$Pbf15}:̐R({q+9 { q@_f&ӤӺ'teطuGQc9+_SHB@@k܋BU2eLTh+ rys?-TΪ% PiQ&x*tӤԢrV(=d`tg@Rꌃq1 ЉK1`lIUKqKR\;5>Z>g$)61t#k)I2./JI 2nt5,e-Fj H EM' c !)P]!s^ G4˴ lڛOuAW77t[E6Xs܁?-vZt)ߐ+:K_=J&L&YK5pfiT1SR/.w(. 4^\f0 E=.8Z'J~PjL>jD5=YC%#1⏔kVI{IR|T{jM@$621Q{skgNT3Q1 1rZƚd̻%NK$4urwSg%?5LWQO Ҁ/193ùі`}G8FR*b4c K}xD;Sr-6wTW{nu"U!KEOll(mN#IK \nèjfԚkiw LwyW:,vi+hH5mJCu  dDfNk1j"pM8iK DND%"tķ~ Ô]'WPQ8\L]+U4\1`oNK)͢;=P*Rg oV{^ѓ\._HBXHMdH|nZ\0 *!6pĂg`֎5 N]L.(m>&7(RfX>ZVF{#b!mfNޞ ArZ[a,MXe>lS^IQ }r.8hUKL=f @|@ bj‚4x' TM BSٲ-@rp[FR)*.n14)IևLLw!vu&3} F;%P;,#^)Ք,n"$``UGUQNDBf${k$LId<~NNl$[/J\>%9e Nюs>);r}쓆^Rԛ?G#|+KIP 6*Dwr%vFlZX/Hh5Qa)NYnZV)$94@?,jZ44|\~\*t}p)ioPX}q.%a2RaY7)R|jX*Wg.g,qdađERo9>c|dJӮۣa\[O$~ՀMF[v*j@31:"Ӄ9i?ȡ <#KLnS']IW N!i*P?In%٠4ex[.CM,sSG 2H܂S7&uFڌU12R4w;nNGI0A2c|RrJg{fi%$p-kr#>kDdⷽkhB\Rxq)J'c S$*dCH[&E;-3-j?*<)!Z  Mu[3yPS܇rPWh*s>h?E$:IQ7R ڥI+'xqixQ 4di)RS^ZXPy,@wƖ,[Cnm <9C(mwݚmҒXw). ] k>[֛hnt{)O`/IufR20M#ZMs!Î~g&>9NP?6H).$sY&~dfj)'s9{{2 n˱qt:rt%d̤ݿ-  ebA9$ &6cj-X󷷶,)k=7p.<0KKx mܣA6ߛ5BSֿ;Jz{/EU5f9#XP*m?w_m T҅@"ůb}MYNnRݠZ8C5-NtuKM>*O`9V!2eRL8E_]Ө TC+}!A:tvh;.)|2ն⛩\nh$o'_ǘ%]%7NZT2$>P{ TЉ3z9TrL=I ☒5O4@s7kˮ촒Qi^`of /s%"7ank:F:ݖ펲 WUI=Q2'b_r&+JıT,MLnP O6aLONڗU]UBIܺ/2"]h݌@)]` h4l*(238ߔt0yAiD? f ׃ai1eO-cxUuSU7:f[>!#v+A!=?IQ2cgX1quCFөQ_غ\AI;QCL*ΦVfqo'!ghj$A@GdjvE:LODBY)*VôǏ `et' 7]U9C0TՏȩB2D5'bTC]NLLJ*.3q[_I~%݂2=6GQӞ|aX<FWCS['OYT>9,S~(oTibʝ$d,3>aW`'TLTzyBZfpypoL*W$̕/<9vĦ n]^SY[H%Fd"ڷ c&4dsTa:AFYBqqAo$#ڹytƖ30r< nxDpjZrL̔g `Q(/6Է|ᾘj4R(%33Vá4bȚ BPCۏ)_0)Ҥ1^yCCNjey6{R*7D2eF#S_h75h0D'aMoH:fV|WeG6z";U@xZV%oGoaS3#7ѿL%VΘ VVQ38H2H3>aHs~^)gJ&R3&,g1gk25 .Pm Kî/p7)03B<ˬ>P8KkjF%0e4IrFT_sO %8|QfDڴL2:er.᪬/q k˔). 󋸐K$lq q e4ںi*Z8)]1 5:gzV%n(U=t$H{hͭL.v29f mf%ү f|% 0ڌ8Ub4I1DGTQa\OBILJ%CPB WR.EPR$vz%l7zFJjҡ-uk[[E_f3H31>tL]*I;iJ8OH1fP.^3B{T UU2]ZY쎌Y˓W.`#6IM:A3X;7-t *{ZLPo!hPkmV"$D>Po0xIZs6&Erյ8faiZV&pO 2U3 s-I dKo_X%uM,zdҏ #=`zI@!]11,:4p&UϤ]0v#1 Jʿ(mgRiC50gfK2G}ԩ+Y*QK$PvR"yeT|^=XkdL(%rAA.!覜̥EQ牠X0!uLTlZi6Gi*6pSc"iՏ @V;ͺm{^P;Knj\NTNgoA 't@N6RPl5٠{ ӏΚ.BSQ0R)3A=&=U5ug2h t+"Hm33XW.֎r,nl{N\0l>SW!9 g ;^yhou`.bwu|ӺyJNܣGhH9go|;Rd $IS%]xtX* wr):Lh L'r#_B¥J dH.IUQR ݍo iq)@Qͽjrd>W]%jF<9. ЫFԈo`!tfj|I[T7I =v:č%2Q4,؝ .泞Ccͣq#Ұ"M}J HiۘļITg#sn\'ėt?AmLHP R_Ma N [Gr[h9;ak1=P+M.u.cUu23\2gPr02^Iz$ʁp0sHΖV9݈n -jĪM\"u׊̴5gK$6B#m k7bJX^!5r쐠|mt,9ѪAtFf{.%(oDJZq-6Q!@m"Z]3!RT# W1 7&ި-",㑌u+ioa:$f=DryrvNEĂ3ΕtrCu3PRFg{ѻ],~- 杻;{/\e()%8Ll!;& `C[w @:*xo2v=섕aJ hn?\ye {n~γFo}M Ӫi 7m^3@Z(Bp5-ʊtITw iK\˦SrCW}b~bT4c>MŢoh9Ćyt<:FyJܒ$UK$&0!?Tr%'fȼ!680Ed.Xu~7Y(oyc򱸡ZTהZW)y֜ I(njaWy~pXm~E5 'JK A4rEM*,޸l2G.ji,hƝ|7-&C<֜ I|Ϭ}Q"膮&j$9b;a=TpS*ZsZڹb˶4R. 4vƝؚwt枳m0CF7u'>>+cTy^,@M@%Rgq6*j+JJBPHbq[ݤe1U!ӯhl+[Ē KnsHe&)/ǜ4a˨:e1#I NkDeqm-b)hFö:[6L*ju X 1'5>e)IB{(=:tHOF>u-4]hZIiS}"*m{eĞyHf/tʝ(Վh*Aw^1R::驘;AubCQӗw }T,Q7E8@ t) 5<^+M44neYq$oL78OOoӶ(v@#t)[Em7$p+R8ԙzARN=Rc\ڕr@TJJ:#l?qZbT\ƙ"`1eAL_}EC+MJeRHCaUfϫ A cl?(TkcsV42nNd>8U!o6tझ¥'Cļ4h="]€4W@Jo̱xHf%dӖX*Sm!ԯIsQ6@)#F0B=*R')iZ'2eVD DܺyKRlvcC]QU֣;VkpM{AOvg8؅WzCo^`I%ؿq_%*&QxJʒMlc骥VI>X%3Ӳ9>x90iQ~HPcȴtC)4C-~yEq($%`aquvF߼+k ˏI?huJPhs0\bb,xʃ!Y+O].H(7~4+ʁ8 þ)q9\2 DtUI(P7o.uZY6R dZkJMKn 8cmt-H^ßdiNcZ Ω0Z$֔L BK4yt0[%DE*(#5 u"IpU}uSU,A1J@ ETˋi'.wHNu`G fk n)e_4E:ҩ-iSs{H&` k!,CV.jfB%x{Ll؇ a\jS $@)$5%=]":d8ul0H KZzSݑDxR1!M:s[CDɕKQ'R:׏* ~}ؗ9ghTPUN >ixhMB IO2kaz5)tɋY#fKqmFnRqАihZ0%:A{l]*8ƞSDuOk(ƊQ -@NPXxi0PWV|(%; m,X(cТP}TTZXhPәd=B_V7)Iˍo峹jܒ[R*|6xw)]Q-cf29KbF$h:EfMrFko )ä,iDش"CX,,hT;#U\rvcEvx#E4\xCuRmc08~߾I`dwǮ +IqnH(/g'[)Gnܶ-ټa&9[Bx7Z5<$8 kn >>f< >>f? AZ2ڶ`E!"bNbLnUl FrYiAi%ux@ml[ߜnxL?ip[ [BL=I !RXs\#om2A[+gYZwzkdz2}O0X44d%l5yơ,k6SBc\ƒI $AZ6`h{xݟHV F@b3Wfo Jlȭ {c6 Фd{b=aaih/p/ Y {#[OړR֝Gd`PӠXe޵R#FxdԪIw$ab( I)fka[Hju\QʞݠDBP+b;cHq] qKk ƢZ-hNW$ ]-:t~ÅR"bzQ;t1Mcvݽ/@={l9w2)`+9z.aILĽ8I9m68 PH~gcPU s61]Ud8g"$,eZ}I2MGǃc.ZH&>xľ'!3V%ŷp v 41R3[^6mnZUy x{Cd3Z Fȉůdu `8lR?vCR ܳ,ÞRM\|\VE:a6K߁UZ9l}’\v@I|99ϖRI|m3D( 4 aqy?r{ARk~qhVhqGLfseEw*uH$hcXk -$cD bK@Zer-J*=Q~zs҄ISԃ,$l6r13~`q\; ZS6o,uxȷ{:f1!irQ bS6C.VgE6ԑ2a׬7 7g,X1TRXd:_R;@|4ô31$zA"!Q.G 9KxC /tl%6R\`Ée,oA:{$nOҏm orJ2iR({!>a\$)pH* % Z,w$5ÄK_nc@Hkf<>G'\Kc'N%nyCp b=G2JI[%j6̕I{,K4,}շ Xb3 @x \ce,$lQbF= Ri&7=J"4F˧c1tC$}YCޏW0V"يFRGTLRO'vlO)k:*>r~:>lfQP$)x1 RPܦ[&9CNn/s pV+'hۑSv[N\3XAHׁGn_cܳ>z:56WYc>LZn6A&Zsgk=D(0 _Hl+}ZX06\It}Į)b'<8LJ@p<W#$c8dHBQ&O(1hKfZR{؛Z3/<֙F$F֎K=G2AZ@%i* }z¥+I!uhXF wF\ۗl(hi- bK <%V!ƛx—ѣS %*IH2 #V9/91pul6l5[iZ:-hcr-Ta[F )%Ʌ-KR4Qe$G,|cI)B$]Y#Sv܀25N Kd=rN6 $yT5J *5ŹcG u-饢dIitjDrP)=BsZe2LqI{ PaGGianUo|%1ek|ѶB RBJ`._&QNI †R6 DRQV&|Ș>))FN6h[>A{n]5+T..Ir\֞ ˱{i)JhXFrMRN* X^ @j)BY%[+$ZRI&0K*%KiG8Serm T`Kmkad#CnO%odBQOkA$J5۸PRnX*\4ɫTRSAҫ%B4NNw͗t<@Zk*=%ryRPvir<f_z{ۼFYV,#SpFdk4o$btisWL툼>Ӊ[mmd ٬BZp<'ؒR)1BO"ĔJ1IlFF.KR[JWغBH˸=5AIU/8VP3S]xŶZX -#Ѽj1|h i=.GbdAEK":a<Vh?hA,I\n}%SpBTo62Y@ U, BrJpx>r.-_<+~UBH!nECϡV| _M7uR0U'F~Y&$0 J>⌿5|yLM_ƊD A:ihM>0N E$/~ӷ.⺊.-:/g)HFKFkR,LRi<$:HqgRȨ%$hVX"Tw)6^a8fN?xUcwtF*ɷXem/L~uAYwXpieF䗆5 F}Ƞ>hn&Ҥ3JґϜe Qz`R^'C]l$@ $jPAtgU} uU_&UqeM;#MgaѱJ~)LxTQA"`X8!;ӆ1J:'}q]Q긍&]FO,F8m0RtviGٷ|"u!O`>M/Bفկmpb[Cn`rjm{Ν+Jr`IK4́hO鸧 F!(d.S1'Dk~[z^piꧦIݛQ yOI9Mي\W7Gؑ8_A((OcLf% RE+XѤް8/y#xjLZA+4|8j%y*k21-#8sOE-P2&,WTyw/֨N){9gpL TM+I+/g-STLz$N_SE btjf " l;^,^{jW`.vGn1w]4|LS2H^Q{tyR b٤jE^Ih,B启F1E CV#:GHSa੮E,Zy֬UKTɌzɖz>-{-nmv>^ҽ*9 Ki-Ȓ6f,v3f*ȬtTM4ʙ_$,Ԑ ukd1E%N>8dLB߰DqV!kB+b~P=%rwI" je1T}~Q[daa0Og% m'%tOfcjUN S-ȁi+ fbRTnC7@X`+[bDULVFSR\:BuۺKd#EeCA#0R Hr ©31ג+iaք#Wf}E9=tgOH)qi4!Nba-\:%1uxIyPYPRZE̹Pnkks퇫3R,C(A2 0QH2SLCs`mCS#2`{' -jMnBDvgxvuum0H41p@ BY$${}P09-bI  5(BY {1Qݮ|c}*9r9hc5$iKVUĄl>9*V%kEeX$oL/;,9V8d`w #2I6N$T}}v--/(’Q6-f% 7 ,X-bęCfݐY̒hg%e6<I!ZhĦ%K3<` HK;(w,qn> J".{yä\/ PK6<ô#O ; $j; Z$= tד>d3\11e绘`~OR U"3 Gʷp#p7.(v ֢.- I-rU1%vrJ7/Lt%XqYh攍%0!m~6daJ  }Q((h<5G agsJa- -)f2˚w."ZiAvxBeV"-:&tة Hqy5jI F,7ճAkK c7l!KB[p,LݜD%e99[xo3$k g)XGzAN^[KATe ϔա%sgX$.qFH)F.>OҦ:"rd\QՊri8TNE/s$@^[1[øei>Z? [IP WmT@//vyjPvpuZyIN𽢽AmbVMu32s p%Ř&M lKQr?ZdbIR%=GCPSJIHR s"3cJi1IE!q)0q:u}Pժwu+rU )H#F3/”gЃ p |2/##}ENl]ٍ٧8K]kXn[p@9yU%biVnn P~Hv3~M0K<MŨ@)d>NR%0YU"lĿ*w<ZS kjCv4Tfm5-{2H*Jn[vA[ 9qC~'Sc8dLEx-U]A"M:֢ĶXmEmvĴ*ӵ8|:+Ѧ"%j)Wn- 'xs%ݔ.7L ]O.FKZG /q˗u&ZH0˜-7 *ʯfV~nmu5Tք]Өfcx8f!G^!-EA(|&:H-28[B͢ik`;.$WxeI匦$b d_ i8Z% wm/x?*)ϊ \8jxCHXWKQ-Ib`{sx ,jDqq :J%6|n hLo>0[gs{7Fi:{&T'MC8)OBT3F5vS)y4z )1P ;Sqt>H$rR nn.?,p+:jdF@mlDWc@.8{*R ;RL{#++Y`NF QI^CNWBUPu&$p2+T\fCʫ<85MXJe8 hm;of.3ڴ%;H˚/@!DK; F Y@i&]Mkdƿe%Br[4b2w,$,6^8oZ-xZ6~PV3AVAsǂ94d$_g1nNb%E:1Ӕrn9gܘteN <.)Ig*,1K >q$ (v1;oѢX+7kZxj惜)U2 y$)KF4¥\5̪JC w%I%KQOT9ZS.S+3(fiLȃg'%R#aQS$ FfK='aAONk /aZyt\i!\Ӗ ַrm5AGCC%JqjA;١)BA7vv!Ab[]=qѯ L깶c/rJܡGDS5KvIgݙ]H PёʰC`oI M;=i]֌ژȼ>Ԧ_UG :j! )6Ѥy˘g-j>V/dqJM'r+Oky% kLD҉tՋ))pFlM#ҢO$̔m Kpw\G"VV \ ئ I>XH$@,u2RJ[GcSPB" 2M?M$R h$OlO.MLL YD3XV6;NXB- X􄇑+HXIHRY}!#Ҥi iXsXF#LqkF#x!!m!ܵ^m=QywcKݤWE:O+y_|O8fb+(Cq ŋQ/>P~m{MB,XjcVo\_{a HrϰxPIJnIF ?H7Khs.Ûs BI䣕vf셌X@ຌ1rPPvC'[vCJIDB1,hԋ1vJQu$[tIK9Ll!kQ)7[?xlUg}hv"۹#(6ѽ̊Bȅa[[ܡ`%NE, Ű&eLMJs X'W/EƸ2(g)\Ť$AV&Τ Q#@ 2ZA+]LWa!pÀT$BF$P%@ApAМmo,&?JLS {9~ZN^zG1RɍUdin kZ1j4Kg0vk v4 y7l^'Tɚ (;mۡuAH,y#9=uvҴfcgWŘd=扨[ʠ m\"A]4ݻmMlcd̝=qND{(70$2D  on hR $-U0~JhܭA8O)'MU$wXC\@¦.r^@JaP"x|76Z-I:lBd=JKdexh~l(wt Yˊs덵JLFRRŏdftuR,=cEA?Î(ؤf Vgh50DjP:go`s7zy%))v"`@ 4Q#X\C+jNq#EG dRMv {(RJPZwnBè ꄒ\}v]"2@$Җ-&4|JEr>ynD6+rtV ᅚGʙP\2RN!)蔐tTJX%"03/rZ &VɧVl6m`*zxdEE,S3d@u#"r~^d&di@QA7(i)S&VWPASokww3浈2{oY p_X OV;LChn.X/h9ЬtkkdzsT*XQ*/V2%bRS1dť:d S&Z)ʒK,:a*L!YKf@%bqZ\5nG e֩#n]l)= ܝ~2-S@0oאG4>]V4LKZ$DLZQ (,JVJg$v&|Vd$R/CXgLH*e;isz;wSl8<Je1Re-qxzj/s]-iwt3=J,}^1O!WM)RMRĩ595>xuJgu%KDŝ@5 >UQG҆H%{}Q%kѦ{K6N@p &vT{zO(*Leڗc6X-n*4^4%O# y!Td (_F0y5ú$*3V4Bz`AR\i Eb~Zi4<F1>ǰQAar jH@QI./{ݘi[in986u`oL&n0(c3᪲JbF֞ LAcSƽ7 MDZ =R)Ifg)wҎ'b)3S2G*b[Gctij,I(PJs/jz&P)$̂!J;T6aG &FT@A5cX)bO"5AbPL(^Y|$HU>/5s.,N}Zʰbw qjE͐*hRK\rRIYCc2!h{").5 g(إD5.@R]N_zW@(t gnqU\b3 #ܴbrXhM`Zwm/1LKݺA!AȲTǿ}!'J*(6/s)B7ƯAXkOR;r2viU9r>ZiyR* CM7ɒ&ʹejg QrUD?8ub3>Nͬ[TXp,5Gdf4 ՞)n9bX^9x7āN\={9@v3 UzIH):Mf!yeYѳ{ Iq7orTӢ; `9W5M*JV0-z!Z+΀z)~`x4=c.Ir[=;RS V 8"OV/Y^S:X2T⹌^o(wTZv݆ևR3Y9rGh{+ UhRe|NP-tÚIRVRfv:ePϸּMStىY'.2sSa M0B\Gbhї5u2#ԞRGl`Dv6ϐ~a0.FbH1TdL~=`< Y*ӘxǒL%s>I=gH్$}xXHNSe] /h@R)Ymu]ò%g=љR~h}D-SEѢs\Z'5ޛe!72mBʔs}Jn{l1e$l;}DHKX~9:6NpC_2[4QS7L4xrg oU8Z$+X%V ZA6Fkd-,F FEЦ A^mM#7!U%vN;٦X~aKS1]%\f,bR#Q\)92\rN(gKNWV4竷D@sjI_P;Eo l}nb-|ۏe XbɏFLA%+k!A$?K$]݀pPCݷ1$zرX3}.^Mg\9.􍅰P$0t&۱Kj,&%)pZx[r%Ob@j[x\kbmeٛCT h{6㦇5ذq`= )Fс:ommdoߢ0KI #Y!- *a.M 6J kd;qSljyѾRH<&1j5Zaip_~Rw2" 2[$ p O侎as1`%)+1"VJ8r <7_'>bR1a )G02~s0 qsLRl1Y!&J@ɺ!iHmYcIn\U[1{\r3hZRo *B>jf2ٍ\sGaD1'6թk'@6nnק73&/9KH :kYUuRm$TUO\Hcb[C`ޗ>ZM ,_6b')ð&FT|(42PR/Ȏouta*TR'Ƕ&yq06q %Qڮ/wZׂ_}'[5+(QQ,㨸_V U&Vi3+CN lMTfQ6{2Ws0uR?ƤM\?6MZ1c5:kꄁf\{hw[NS*[=4dvi 5^OiB}u V`YdVdJZ-c.DBlʞ˖͙S0]M=LΑ34JG,w*D(E42Н/*h)W0s{깁9Ҙ!.CDy[1IRKZ4 ~Y,n726i%`3Vf@c^Z3ckF(Z5 Mcp㼹c,ashʼn~VѮ owy\8Rjo10 m+ M=䭳(cpkOEܒK) QnѭQRRzIDpLXQ۔JPwaXʚ.LW;vDԉPqjO|y!h#0kZOX!Hw{n#,KRB 7rf(! 0k{iJqM`ILY#ijtp/ Ina a>s-rQrA~]:%uJL5ru S`&>W’SóHFnv+R 49]ӧybʎt=jM8-P<xWԨPy MS)Vggs#fbuJ"@JRڞw&rQ71> m#fGr)uD THC.x"iU!%[%bޫj6F# n<+tby6< GXxjRXotζCzڴQHT`9 eڨr% |ZRA .5& eDkPtO97\$ N>T$qIRҶ$mZպFD|`ޢ}X(-~zF- Dgڐ]je$Č ȏRK3^-M plvvtzy]ۢi01fJ޿|;@{xlꇲ:sX<-덑"CZ0HZ9F#&6a;%`K62–#SDuu,9MbF"YRWȾ=2Q3*Z`ư8H҂RnrɊϽą!'W66'v0V,Oƃ6X5mgWI LG0qe ˖%)xŐbz<;ɞ6Bw$\z䜼%itS ;D~Vh0oUƞ_T\NK!99t׺07_G+[WFS5Mh6Lr?'vX5ô YSvg8BfƱr#Dԁ+BDx`7g7@P i*Fk7U8KN@9o31‰`n =1Bki07$:tK=PW7(&T.l|AaNM@$=wTlp$[ty $ev 09b= -^pN ʍɶ{#Z$c4"Kɿo'ro5D@X-J$_ǔ o԰E  ?;iqաs]ZV6hBY K- $\?(Z) IqoBChZ2-!5&X9-{Ra(cw0@}5)˷l,u5`)`7I$ab+F1DXǓ% , t-jS9@}mhIx&/0M\@ؐ)$3 Nա9FuD-3Z3QhVΈ NL\2O`r+\qfڻA>Qe<M:$)+Y%0F\(Js@Mj]>p?T@-hiYK Q,k HDZqP4C7w8beF6v[D(-VXo{v3xgV؀J1H.Dx]?IRT} "/?Wˈ'?]ڌ`THnQaJ,Ucm1!#PT #[v s0:kJYp_Z :xwQJtHI  ʝULH mmN#RP,- J0ر?(=Zj {rXJEE`0 Ι0)RU7J hH{XXcxz=-s;K`pbtsNR0lf5NdW)I`,wGYT s"RL@6` gJָb 'Ө2'\#tjC!,x; %ΧB* C=r7"2D(mO&f.R[ uBQoNajn9 S<b 3Czj)aeC'f=m1QWH, fȨZfJqpHtXpSi,/lx]CQi JlYiSϕ$H}3g|jc6BY)HZ7ԬZ%&a2f,e2J!mb0Ф b6KfkxF! v'zXRl{DjcrXrb5Sr}9mccQFSt+ qu'MWW!6uH'Q9%^i/xRHhr h֖BLuX/?J@$v0{a>4lm@ ~O'oRRK'`G̚)IHKzХ>YZMJA7{xB3>!s-'RNJ=S7 17R}%BCkA >!2=iS|(vSH&Qq 'HϪH}~ȌNYw};'D5Oy*5;.bvf{8ڔټ_T̩NT$'KHwKBeJ7%Ǝ^Ph;&%~SxqxjGux {h~K(HFХ Jd#F[ f4Yd9FFFDɺI0NApo֤_#4MY1ADr wyƒ~>pNާO( O/:[_$e )AEJ7)Kڑ?\5-i|~veQےluˣu>+E^7M ` 0$w4NunǾ6{CuٯL:jk4aHqO-Ajfa6RB>!5,q\qBYyAS )g'x,Izd+3+DXW;Ce7FuOxBj+P J[+O4%hoi=[Lo-cV}y~b6# JP H:z3PO|k>p-L8u%gqbwc xuC&xG2RS:FN@0%(-!z݅GxS8Bx\q ^Rn=-TJvf?b&G9+ApQ&0b6l=e8( xC)y8BVhȈ[[[Fz[ /GU5_|$ҰҷQeE=rXzbB `vN endstream endobj 42 0 obj <> endobj 15 0 obj <> endobj 41 0 obj <> endobj 17 0 obj <> endobj 16 0 obj <> endobj 45 0 obj <> endobj 46 0 obj <> endobj 47 0 obj <>stream HlU TS!7pCi7YƿbZ@ *%JyhtN8@89T(Z0 ڣoٛݺ.{{y+adD"lI\REи5=dƩqdog!Hv_X7aH).TX[f\d\d+-0P.85"bz1>X!?vy{:ip7F7 斶+%Wn-ͬQi@_U'ҴYkNRȃ5 @ELwP} r+8<΢ zaq p?5 ([TixA8<ȏz_U(lUU]{7mmoڿcV;tЌYь>Cw+o=qAV8yӕEj!™]5%}zH̐ KYbD-;]M''Erp vi,K'&}tHۉ <E%TU8$ҞrRL(ŭ Z-s4x g!; r.ra c5m,U>No;/]OR6A-:x>T 4a孵9E uDjö0?sC&K o5 .-Ns0@aINI^ r G#tt.Oĕr?5e{?}͞Qgv.\GTJ5̡ wշIQ-iކChzN;6M[csutA.&.4ݗ5훺jə"Oȵ-?vb_1W s8ltHEԫ6,˙QY4,qE5b$Ji`V7B*7T\&dg{d%ӂ(\osYR714f!đEEBwjY3UoEŬyGQJ֭99-fǧOw_,FU\gV B<eԍй]oZ6-[1T}07b(ld-*GXY>xv}<]|}^QpXPzNs+ceziV^h;87uC;F29\C^.Ph"ETZE7UǠ8b j Œ  QLʂki{ ?fZ3眽s ˷pTSKgYvUW*EZ-SmE%%eDo)M<)/ ~k7Sx&8i }7YLqB+l.R$ UUߗW龢 Ӷ̺w6 K>eᐇ┖NRh&)t;2A,Lˣq!;hhݵ1z=en;)^;[+iUj?!IDl!(kV\\mĶ.‍IGC̳<7%rp#B~75]lOf5/#[ڻZ\1OFspĴ64&4'4&契$h1"@#o?k׀d4P^~.kj,؝^eJK mI^"OER %ԦPMbE5{GLn+x!IAto5A]O^#Hq_6**ɈaWHhIP F]k 2U$dMZ}mٞE# @/ Fן.]\cd5w?#3g &1"XvZ^v3g7o^Ɠ'DCj#G=%(/m,8~u0}oaǀ82p"d_DX^]OZIb)iΗ>[{"$#||U+[T14?!:G'>&"5\ѓ n)$嗘pP .W{,XZl*u-ٚx3}A5ymL?g=٭Y .I_U_O,toh'ȿ$]U,GzΦdV,8Gh^qh >_Fs:eF CFx~ݸM)}='LͻBQB );Xw(+yVNV"eoӱBuUVs~n/LʈRlav:m%7k"E!-rtJtRѩ=yr{?)8;i{n\ `3L~aR4$r_ J^)[Uzer>P↖ ^NP~gf]/P}oyJ>۟I\Q H"G/r~r.cNdq*i"q 1XI2ajXj94g}3!/Νxb6g Qs#72."V+j=XlFJ{ث0~ o/>=7} [o ɓ#TRr؎+ؗCtA5X-> endobj 44 0 obj <> endobj 48 0 obj <>stream HdTiTg[B) Pp(( 4.lEZhg 9DgN<:F1 F]$.Aa2E=b^{2FI}{߽hJmC4_`r9k㚌$Ӫ IcwŅVFW;pQo=S i_rO8R*V&$ed^ju %\SgNq HOw{}iٴd1L Yu&7S*EѤ3({;JOQ9jEPSbEeД (j7Eݠy55ZFQVұ`3fMI5MuFի>~D0aǰ`K*FL֬kNZsm?Cx/N]m};Gvvq;enm.:h:ఢc¦*;Jc/d|BkVpx 6J xvM])\c)ٌ'F,bsaFٜayG.O%¹'j.f|6#ۜif;`W~iƴ-Kߜ7o Eo L`!bخ*p;;ȕ&DUW fBZx2GEE]ց8&*HItz.AޭF^0+B1 Ã0g?gOQxO+"M~0Gf,4*qY|p$D+s.;++%d!ƓbE*wM .-aʯvꛚSQΨ-rl`ْ){ 2`0PO(g޹7cxù8wsZ+UW{zW̍4g#z Z',ߓ6OY˭L4kWpOUD$IYZ՚¤C 0kb#6q63!f<-!$!Ü_RyszcBYT8JhO}ɋebLRj]n4BGC2Mc FcBR}|HӺ{ \7 IH${//ƃŃlL`-U)͓# $PW䕫= nFXO 5?VGFWk5˻b#W$ rn"}gͭ11Ut*P'r%h''&a/_Ȟ'2[EhndzpF=EYPPX >B-z'xηZIWB%'J闬,;29,AAeB iO ѹko&tѬ]ZubO L[o5c z j$:,,2uJ0.}ª W^2):C Kr&q{SV!ĞnуmO#TIRRiV68?gx%̸x{})[s-"S*u![^5!̟p$,X Ш߁TaI5cfJY( .o+΄yN"z:)oQXk2tv6c?,badc:Wqs  }9_N `[B(d?4*+CPasz%$ qKZVqAC*B7.ICc481$(Klh J s\1*F(יW 3|{w_LpCRVXb@S9 nA-7Ca ?2v12+xkm8jjhs/ w1ށqܝnv|иtPVw7=6Ad'D O9P\%)=dhޠ kg$zy hW/HYq)opX] | O%d*"]Su0ͺyj0ކ;G7}yb@{&Нndký9g?ۋquF(7s*J`u $E_mQp( ښGmx Bh";oO"&Pa9h'sMF7L>׷ׇ/?>ZU눪 QL* 9KK JB i9NΦ3z-d1AqT7^1bc'TnbV=#3-M~dk&KS\@: XH?ުz~uKz~HQ9K;ض=i%b=2جDFJbz<3ou~[`b`ѡ1eWSC=mگ XE58sԀ%'Aw:fߝ!&[Rr5_UaDE{ߋ^ST=ZH3|鼹0Ky~BaQ,8diEm#V=j떧N<,f:?''??<.LZy )grcdPiˈǎfkrRie n\xqxl t&~´SUx0oRe)gIқy婁b ;-^V̓YYE-7yː[3a<{ʠfZRSp5SI] +ʿv>Wt+[@O9vpwfkr% # 8p;?nYӴwW9sX7sU _O #ZFa2qs;ԝ0szVFDb]2,ZpsՖ''L3.ǽ5'MKү[ꘌ/>Kz+9ONJefn6]UKtck?okv<97[vhsߴ# 3DRqڕA)\ێvkâ=V?"5v{9yG/iOUL\-0#[%E.~tLP:XDURx(_{é\$C+gKX^ 67$NP"2"ȈXRs=P q7xB iH0] K#(&|$q~mT`-RWܡTt][4|@P%{2Osi>v }7Ɲ1 ɩ v =.3g@}Y$,|_:{חlV/KSeh_#58lARf {Qg@uEچf;}l^tlҖC QC!٪C!R\.o;bSHXZ03uRUD=`qLT23H6{Kf濭Wh;0`U!}EGԎ endstream endobj 14 0 obj <> endobj 37 0 obj [/Separation/C=100#20M=70#20Y=52#20K=60/DeviceCMYK<>] endobj 31 0 obj <>stream HW]6}7G)o&m")}],dr*ޠ~ )A}|#QÙ3g׫Y"٫?&b^Կj7SL, SR2ΥI]&SFN?qnGѴ\B̥_Ok DĿw %Ӊo_~])\db97߄a)bTyI#jk1節_ޮf#iy3b*iar'\ͽkk+lQ}s]3TR'&G*@W}ݿ^pgMeX-޶^;^.r 7-Wj~_m=R Ǫ85v;_ކcqI*b5P~"Tp]Tu<v"5O8ܛ,i{/v<0ڗ^O !x7$ :Ȟ ݖ蝺?kn 1|*Z\ڿvƷUa? 9щ_z꾬J'wS{ qkO9Ue -s1/8ҏ&>Adap0SLjoO0sIƇy0oul z&F$' XHTB37'0wDzh%oZd"vdK;/8JR<J( y8v+G?(C C[DWPKO? E)_8wbbeUC.AG \k ^4X,ob[9N7wAJ6`c%,ci[J_4H7FT~K[(Ng׏orļqQ2Ѣ;ݿ`~Y  -_JdzVnD Pę o_~Arc&"a+1:Qs';XoVA9R#Б; "eb^JRC:j6ZE]XÑ{ogR#41~a|rK70h.?̤vu/I(g7iÍ2MwȱG0Aas9ql"]ӊ{d,dB ݅fhj}CaX1bX5tMY)^ړt 1䅓m$U#&ՠ=N3'I q7ڈY5|5XC|MBmnK?p_K)^5r54,ADlEQ:=2Ah`'D$U(@I<, xz &;)X<Ӱ4NA3 Zf!7nAt4DMb`*c}q8(#m!zh1 X䓘Z`|&f$c*ÛD!ц MЭ+HC'ѹr;&@WTQ 㼚\HbJ:H/J:a NWMoSn`Ѧ]a;,sMO? { endstream endobj 32 0 obj <> endobj 33 0 obj <>>>/Subtype/Form>>stream 0 0 0 1 K 6 w 10 M 0 j 0 J []0 d /GS0 gs q 1 0 0 1 566.9291 54.8673 cm 0 0 m -538.583 0 l S Q endstream endobj 34 0 obj <>stream Adobed                ""   y!1A"Qaq2#BR34r $%&'()*56789:CDEFGHIJSTUVWXYZbcdefghijstuvwxyz}!1AQ"a2Bq#R3r $%&'()*456789:CDEFGHIJSTUVWXYZbcdefghijstuvwxyz?=/x%UrLjŋ3]7\]Ԟ{Fxŋ%7@ԗ5+jW,XNt:%mi^JXbI=]iFZHJkҲV,X't-$ V,Xveޚ񲤹zXb%"m 6G,xi5{Al-rDur[]EܭCPǘSl块&{e޶_?-oCM>l4f;mY?â(l*}:m7D5[S:oޥ}AvYUp\4<5l`X9+Q)Qcz*҃^ʮC&c'&֭ cȜ xD)k( mW&ҽ8IՖjQ wM$.mj-gU 0 xΆNZ>T![H*! 7!obv"CrXd=Ҏ沓vGTT'"kꅹ,G2$ʝl53sD#C\ ֕. S0 p -9jfc2tnOLH#B׎F%&jw# s &m@-= :x4K]:+p)J2b3If6q^fh.s4pj+0D Qvb5" w&脹q gp7Iư6!5r@2^u8LZMPw"t k89OR6 J4q<1& E; nuK5>̔10%=M9MJE/'=vKqvίS 2nyԑS!yyj)#aM}ݸ;+vL\VARm r׈IfQ$-銾Ξh<wl-f'kÊ$[+ ,U qV&KJtH  ŖQ$P)8*. YoO<dŜ2()d u)=taȞOO`Q,^hp#ږ]͈08J[eV2iZRs?\zIS ŋ,Ju"5^zŋ.]%%tkD,Xb Kt/2xHXbܓˤFK!bŋJS5tW,\68/rp}g!e Q'&~;ORbŋ>v\Uw߯D(u[V,X]8/~Exh+,Xck^nؔ RڳV,Xx.r )%bŋ^"݇_RW م,\df:tVbxjq|nt(}CG| 8`l, uWI)!l{ ʩx[GN6٘Mv'H  ~DUvYm;u'X%-3ľt7ylw핵R[9B~7);Se)8oj ^Kr3ivU`cKȸp8@!YWi9LVڴ hKU pGΔ[&1- -a2\w+ƹacb=Q6ՁkGZ%AIXN aɮ9>R:M w b ڍW$ZuZ*ӢBx<9OZg@+,{. z(4o^*T- yu2y):UUNGX>x&82g.צJ RL=IGjOjF'[E7#!H5 \5-eњeKJ’Zxb]CK~P-88 +'dRge״#4ʯBtFT89QYOg$$qHmy n(% pXDz߽HnϙBxu&)j3V8#6\4֞@@Ջ06S?H;a#i<;^jN^pU2 N]NJ)c> \LlBCϩHkїS%r8:B: 9E=g0ˢ\x4 hΆR9"Z׭y +#!0>&T縌Y)%8nn=uĿ8V5Tc37$O =TIς<9O1@؏ 浐 \ qBsq- g_*hR׆\D5DÅDڈX+ĶIUYYŋ,]&KE,,/'%,\K^ p\=%abŋiW I:%ybŋ+]'5ŋ.;mNLd,?r}g!(=Jŋ/=E4zMaVՋ/UY\IyڅJ/c%,]&Z/l\u^j+,XN+Ak'râŋ/lf.8A^+,X ԯl,Q13M/&"K9; ^/RF.\p}ѪhX&C1ʷLFu*Vd}Wh$ZDlmwU59·j3!BZ"r+G@ֻ+vkW8+&HP2B!Ж:+ggIL-լM?#U؆F5HDxNq֥ #EtTa sJ-%u$HͰ] AyBau\RؓML) Q f@LJ)lxdry˾3lUܭC&)xyKu-"rQ,*I2ep 콉8j `ĝN\7hZLrh, _2(g([C#rʯl5o0d6hm5TtIi2j.` ۶ GSI{tKZE `%&R,Xƕŋ/;qusDXbŋ\$w/kK}RbŋpsJ@V,X%ۭN ܜhYsWZ8>3V,X=Ct]] @Z%&VՋ.ğv MwMSPЯV,X/5w/65\ֵŋ$Yy+2 sj4z,X]˶jhRwI+ bʼn]@١ZQŶBXPR Ph-E| (DFl޽F#8CSdytU#d% tS#2/4ni, 5* GeR,!ryȳ /] oԖRnݍ2~/d i)@`KT5n);E Jv)|jEXx_4ǽVRa9f,䲫qmvÇm͝5X3 rk^ayw!ٴ1J0F+CRuSx=#H|j|= V7T`rX6w!Q5@sue+,Xw8./ΒamâŋJ]T$vذjbŋ U/s]}UBBbŋ+S'&~Vj^DB'iV,X9A>iP [۞KP4^,Rl+e)Q(^lIXM-(Do;$C f᥃w>Qꓪ.QU]% EhTl8m/Ne9)8dHX2->ZCk;XX DɅ6CLH4、 MŚTn$!{m]Ʒ<נI,);.v7N< QߠKtqNMɂްH4ǑyX/+MT4Js?FNkw%4Y0Sc3+s%G@jӘQ+ח@5 ;3%xМN=p .}KSl0@X6L%Iѩ'Zi'%JK"KVVQ{'cZHeqO8% %Jla%6Wzv!Dix6ZcDᨚy:1$ 7n 0u)ZTg6sMA AU:. `KqpY813U'&~v,_<*G o)H:mXbۭ'ٯ]Dz).7@m%bŋ.^aI&n,^ Sܻ$wyY%j4 >`zxQi]ܼIJxq.h/f jܰ/ [B9$;XXe{Km~u%a@("d#s9K3-*00fW-< In\9*{.y@TӚAʹHwֺt<鱪bmXbͷ/^p7^s\bŋW\bq -nJŋ,I^)NA{5fX^8ӢS{v'8٩=1阎cynp*7p2r4P0OÊğ9n}.yᒔVF1Ҙt5d5)cH%,vEoɧvELI$+Hu: GE>%&c3t ]ڢtZN` άT>OL$(*\Je9Tmx주'Lɨ^jz`LNj;e)X!ݪ6%-% \Œ0齴NΜ:!3rv=^:4O,:s,%1>R(Zk&WL%ˌ`偤o.R&!^AL6ӁL?ld'#՟$00QPW}Y2DZc7Y O!I> 䵸6%tQ'T4CDT2Sio$$P6[ͦ)zŋ2MJz:o1X԰2^V%:NQkwRs%`%zz) My2 ҔҖPwNטWf NsS͹%<@K!)p$kܜ! $+ m/ Jp^ z-^5q0+uYV).L_*iuȁ ̯K1I%u:{&o|O))i+t)5$U%pH2VfICqrI)^%Iv%(7 WAx 6*D+<ĭf$g,z$p^L?@s6; iZ}B+[KrTȱo:zUaPu+E|_Խp1>Eq`s `-*gZҾ9d7&bffGTkֹ .ktۆOx$ VCqMc 2MH0Sz*!{u> z3YTHrhC kKk |-!͢wx hY r8Ld/@;x<< I( LƊXz1FyJ:k{^/!zXV$)=4^{ `^#wQ'Ȟ}@{:%kPX^.͆5,_=l9H’8gʇb3bH23ñ%%P.ͷOfyFbI藁s^ Bp/Ȥ`$NͰt-€il@/jR}*u$Ѷ&ZJci5HZ&`! ɲvY0N_]ynB das*[k{f"vfhVIZgmlypȨ/5 r]^UIBi%@7֔B[F O2)t.%"&9bM+ήwWψ-6^n-SLx#MO2q^ p]q KW &25[E+'[Ƥ:G0IfzP3J[-cMi(ju)!9! ֕IYBS2a ۯj*KZGy\ O뗫ԠIXG+ 8+!NB<`8ڗ(FؐdF!!6ұ5!#߿YpӊƀM^$,XzGvVVGNԬ^/W=bH] ]zd%VՋ/ "[q\.v/'rŋFݧbk0V%gq˃,71!iM uu&%Z%0gĠg,HD u P/+u屆I9Vk(ILK!hO+v=nczklA$]g`R zTؗ8`ҁ` _ay"bdᠴƕV- ODF: bjͧ6ˮkIŧ7aFjnGHZw֍T0͐5)Z>Kk2`'Q7[D:Z-IJ+Tlu:7|:F;R1ҒÏa OHִR Iv$ry.f^u5خI0iK̥ :"EbY,(T]ɱ ^LJ7JgAފ7/S ZҖ֒[Q 4%#<ӢŇsi<?4duDԦgr7iQ^ f4\nW stم!#IDMY~]h4 JwcuE`dC\ mr!(duKķwJ뎩N9Bx^/RLM#+K t~Tw8`9\dum%4:JY) I[,?&~:s[?&~'h^/WKA#^"]i4O̼!bb :6\/CWIZ (ӵ%:ԴjWXbh{Q-R \TlYEֽ1 S9RJ[~JI$a9RA-. c]1̒vM-bS#]J i\`ےA laA߬/(1qn63.؇xwr'XNJknҎof׵c[s/Rr0h]p8w]j.h77tohYZ=8ZdP9?͸bVXxtq^TfZWai9ޣn9YC\}(g<2m'Sp'iDfv+Ӫ54X,{1k Y,v>It``zә6 0D1b|n#A:`u벯v-b0!7j'6' "_5ZmaRNT62SV$*zᑢd&ΰoLL 9aLZI2E{\m替I=dRR`BYz2^4q2:iڬ((Ku0p)DT†Zx0j@K738*N>Œw C<5p|a]&)ncπ%b zU4 dlynLѳμ4+֧K"VZ:9cRwb2Kz.*0" fB(vYR׋XǻƵJs%h;'0M>v3p$<95 {sP3%:͜=gĈX|kNts [ 2u{^sdQ&J3 ԷsSl-jl6N^GGN=KDR^lZb3 O;VIpJCCB[WlrY =$agidK[cF rlSGE.eu  "LWWFҰ{NaMm b%SrV1oo H!ZzLa dpT\ qVk7)5pM]J߲MQjfP֤jnruW$5 uԩv-jH ̈<3$7[wJ惚ޫYo^,ZǠ6M9JvG5v72G9|CxPHs2KkI"(IRV,X^ zQg.44@4h\GzH`0/rJ).٪]X\ΕNNMa$Ev{}g!c,{}g!z4NQX^+;0z"*Fݬn-֛+UJffتʼnܰؠ!{^Lv;_i<$t{"NߜɪT*&zV.,0ac LjW)-$NX7|R TdQ(=s8A SV }jX] wNQ9@{B Z3RdIn]#6:/'a]Mb]\Q[Ap0TкmjdFfsZӈȫ uE6"\va'a⑥qhzyW7i%;Yԥ;SVҨeWv-Bж$2 wjXSm^ۭP$h< XmV⫫V1Ⳟr 0Ma{De}y5=ik.Sn[cu\،g2OgMVVptWB&osۆrR:BR;yইfop!nӕ3MZ AVSr8Gg]J3Д7Mb0TйU j.>UmiRWC›FH$H\o 28h:w&,&%h8ZJMI ul.KvSYa/ P K 9Qᯑz±`OtdIT&׊$ ne`⡽GȖKkALй,H:y'[PU΄ ){ Rs I8|Yϗ$٨J ,}`FYUగ .- QS@Iq4䊪Z['~7}4D9Jv*RqЄLbN'2 Jb?H/aALO!BuK# b}DRх{;ƁZ.8gm7X(wz@=OPdNi@*Jq9<x)Xq!T艔ZROFPFiĚ3B2=l),j 5H~ ySH"s*PSo|(rq4Э{ծƵ4@Rc} UyЦ(G׽'FjÉNؐl- m4/D`f;"J M&MuKi( 2Bp!7+8i7, #d–qvlBrE9JT;G6卉< 7TJ9[Qbeh|;atc91u)(BJy{ZKZ7֥VQn }kX` FTcvx.*zVpMQ[qs,&;!R8#hfh2$Rp)]p:r\vsnt㙇xu\ySFn43pDM\hNDXMG/Zrj,޼9+n\W4IXuH'5bԶro11 e!C!y!=HV$$;<e:/HSZUbŋΧkWE!" tK)跇Zt,Xzʼnh#{]{zF]mJK$nYJ$X^1Nޫ!cy{srwq ⼉!l L d˝!k`[vhm<-ٜq@s=U@Zre,V`-kE&B0FnQwhȍhtNOx;qҖGqOb ji!mM`iђ1E7lvl9Ƥ0\L +.Fk-sFadDIU\eOVi{*/+@8`Q9k:A@A}l ##$"{]cțyW0gkI͉\z{p%DnQaM{As{8'N5ɔTgީHew:+ 'R)1 <N:'t:ƧښkK.H9H !L6ΩA$ Bժe%)S0`V ahM٥ Ehr`rEZ4)N)s(QmI%FĞJ4xӚ@J/I '06ؖ2tKF 54HJqJtv#`:}ʛMe N! `qBeR1+W>5/7L6ʷ,Xp{M8۬Q ZaJbBz<+J$]h ^ %R\ѰXI%ƶZn]+//kGQaR;=Z@:GcX8 qވtߗeeÊ7YB.\t)$jl>!wûAoަMƓ\,0Mֆ.>H pv<avP 4ϥHrNfm;5IJK ,Jk /ƀRL h4Y!`{!V݂< ^עDa{~E{,ژZ2HB)3QRWBrV37CJ؂֐iNmE8X)$p]kl^[Ywd%czax\JThNIgE5RC W4% Ĕ)ƫ$˯']|d h؈a$ɷjI ɐS23W <{] T24 9a^U=HȪNB4# m{^Q O2D4Q"!4Òǹ.(i46fZ4vBF`+ 8 ) J29^G+*^8UvrKo<䛡 gE,GK5 XNIĝ F#4MmhYd BtIvkhO儦')=Dŧ$a8XLWx Eno'o7 ඒ"vPNPw)LH^PՌ^woIû|s:L55$a[!cQaa1;5ƒI_z l[ u 'Wӊ\RK#$I@Ή8EY,3dJ[Y86v*\ [>]{OnUvI)eol?Ǚ'7kNǁ U8ݙOl[pְ\Џe6Ncx 밆@\kp̶4KQt^Vo^).'_+hfbxJ x0wUحAoTM8V] D-XܸBҒld7xo(Z TxÂUJ<St>$ t&AšnA+K0,3MiJ +Y%5Ĕ0rLFDi֟{Am(qdVb%{AN04LY%Kie94ӥ$)uLI R3EtYNBFdo~$p~#QhԐZ͖v֢5ύ{˘9q =;W8 Ntˋ].hO9'~H&rsڸix4njZ lfQ Zi$bX$XDl" 3(k쒹of!pn*t*oj:Fr UNp|7K䦣xiyȌ3/H^%YZ< ]vW=UVzG,\&roʻ ?B;]V~U_ MW:^Rs 99^+8 sqC1u=xI,sSP+4?RJ0WrŢ!FW8ZHr>paݏN2A;q뀬oj֕;zM e0@Gy)z6H!"K!|J]G҆s~NZpI N<?PYb2ӂx$@ c\k[J-'Ɨs/LqߑO'\DD$B4 nӵQaԕ.)":W@po\ԝ'Expy!yշH&,\,wq}zw%ZfBdm8%8 d4i rM0V's #\=E\ߊb \[GqOZr璍^ R6)xM7㥎+bkRFt ^ /.kKyɟ*'Y u} &IX:lW:⚒N;VO(7S Uz^{F˩N{m0A{ `K:$RW'.h8#!ʳ<ˊ:ݼJv)NDNkb!b9YiXCMUv6 'e:<a1FV9l[0 htYJ;C2)M:"V`h ޥ͗73Kc | k6 %F}tE{LIc^ 8nf\I$NPO&` &ShIs%.0"ԧZ7M?+zmpJ~yBƃ 44)@r=:Bo̭hJ3z:ux×/rZ^&4dٕ9G*Ud2Bl T\0+y}k`§{otZA=79zS-b!٥ԛ,1ǎKodd bD8X!)!XXóDsPH6`J>ޫikH .؀kMhWqÒbf7T`ncBק]rսl )pSGn|s=֫^ZN^ P%NmsfՇPCNa5Wi2 tư1-=גlڲ) $+}=ʌ @nCKf5? 7pGpYIQ>Z؃Xj/jD9+5qt%`7I9I Բ})BEYsޛ8C1"uBm|ҡ!04'a0MVftyKMCQ7ֶeݕZo jO}uJ@${ ',[% zuE@u4'%Hat;KHoʐ'43^$)45LPѢ}>EiNy I2XLIԧJ]=tJþ#.ьWZT;Yޖđͨu$^H8̀x +}OT\N)TWxک8wkp%>rq2 rw'A&TxM7`|Aj|ub7n`{wo"8ij( 4o5hNar=0;:lnZ"#uyDF΅"66h:bQdW7VǾpop%]t FqUJ$MX쓍- R*HiuW>ZD&n^PIaS֡rfw*a(OޢI9JzܽF( ScTZ\uThU6JVf)A%HQhq nmD[HRn.B}wp=ax3+tXI^Wu %| R+X gP}{DLn^&=)_827}'@8 ;G3 3Uz [r3U-)z*iTی"(rP"$F)فP62JĜtG;R6*I}ĥ(4hV,7ߍA5J@:ho'FBVdhnĶ AȒtࢭV3$ jŸ.cA2U\EWC!Dx,8e ]9lė1L5T]1Pk)8LJE\zILm)T R ›iMޥ(ַ!'$risN ꠺YnIy#9%mb;Rx lJ-$xֽZB@"f7\K _U˘tVjT8IdQ&Y-ֿ,)ȃ\ޓG5-vV뱪$ :T|>f."L@</I-<}LI4Q!vzeO2 S~JLt#PK%LwkmSr4<u)ZL`ҧm(^iRrRV A[Qq#(9-,V?0Vpdp-Z o;f=mM/>jw-;վ\YC&qV8ih2) @ק:rS `nQ)J}([&m7R=u>Á<=Hb^(Lb{s As39ÊihI&{6]:M `G rsHA;4}chʍ3eflH ˸vf/kza2d){Q3$}&׽-裭CIQDUҥNe i|@$ h7NA;`Ϋ@C k5R$t{1/)eZ$2)-A持x`euMj㕀tEkKpPWZ kqe-#.1t% |~L7(C<פ;nɰA4(g;P7Br&TٳZtxR-)`:1F%А8=t)*mr6@ nGI0[@};f9nd:R,N>4CZ8[֎l$I.&$M!4&x=ae%]*6Rs4Z_ith0"{x4@륭a`m%5fsnΉVF떽tߊI)\D旝HJ $7O(JcInn ggx(i޻rBGjKr+ s[ӊP *΋jR=I+ŋI#Q}ȃgۄAMW!r_ʳ / JԧSNW6F=#N@DĎ^շZ@:*Ɖ %28^I׊^!ښ). IN0IGRD*I\w%J>P/ˇX2EȄurnSb!ISsʦ{Ld÷g4MB:KdL5ې)FyD"+rU9:|+cKș8&' pԨq$m8&5)[rJZ7|AVfNg֤(xTnqMp1,14F3"r"w0 NC|pI$HBQ=βݕi\|-UYzS -k^8/j7 ]>c< !kNjS|AdA[!~:'Tg9D\4PLi~ > x-(swt'<02é=eLT'a7FGIȇwY[U\m,%d)t#zW*Y$4PVc\uG t( j1*K5N%4U+H᭱:{ibsSXӒ]c-pTLrY3@ 'I`^aƀ͙Rsm@4Z52O1-s1s`<*s-L*8Xb.KhȯǃJ&TaǁQ$NՍR qsN`NJ1LA"D˳e>XFwKf9i4SKFC̅m@sDS 0^u*:r0T#0T(U')DTR̼O1ءF]T%IS9|hTl{S]bI.=<I7tnWtI{)!#%3AOCrT3 #3t5ǚ5̎`N5v[ʃ4+uTNGwIFOF%7{ I-%KRDIҼcOS}V33Ђ _Rc-i' 1dlp.g<;SXfh iw9eqD-`  ,3Qy:t'3'2Zk)/-5=be+t' T+Uo)1; nSt^hd /:t)]oo; ieK}c @BK˩SGJd΢0խhܤj֚A CKSdx:`tZҫ-{tN-\4 #.blEns|BCG9>ֆJ1My9^9h2vr'!Q;:[MȦEQܟ.(S0n56;t|, &(M[J]cpJ<֛P[s q|X е<@؝WQ=sNͰTֹ]JTc8ZA"*2m< IMv=$Ji K4yw^*Aw!&3ycs m2ӢzS\&buj:w@Xbih_*XtnΈ^nNJvŸL;S_4)O`ܞޔi{nvIJTe uP1{Nľcݙ&)j!H[&`*Y9nJvX&r0*(p;Ф t- RnR&:wTe YO§3q0$ʫَIC==܁tn'aM?ð3ԣ([uVMehW/,Uct6;pSP7QZE^,s3alKv.x!C!K=GS 4\#JIkoj|$?$ze9Q9xx/)ih3</0 @#8 GڜH!=TeJ"Gy Gb"Z\N|jnS:+&JFؑQinK7U+JMA"S|>mEw8@@^֭ј~/cH;xwxvr}'bq/T̀=ԟ{dw4WԽQ@Q <@RvITM.X:t)`p)=4dP@)bcXcc[C"!Js` *KFQxR9=x-2FJ˶L_t`m)@{L3Q.eY$.Gt < fNY+X8)4s- LuB9R5OJФ^.h[qI"!6i(hw$8Sdu Ӥ^۩+>:Nv2X*Fz蓒(CtӣR#EH8ڸF(&`ƊCW›c-ni [y9S68VݳS'Ge'zvkZ5qp1x'\#@P$2iT#vw8e4\{R0`]K %rH#(tBحW 0GջYIcwIX ZR6B^S14zU%Cp1a<wf8!n^G6f\L 址qtd3'|,`0/wDsk kYb*Tz]碛p$A1(]X )w@Ug1 s3!U}L&\7Fjr[X7p!ҫyIjbtsF](%Nh:8[WcF(~Nav9Wݵ6f<)|87EwíYNɌ3Xe9KX:ůnfsqSqc [,J6T.$̀ ʕ\"LHKs4\mؤ.{4ayJ4#hӤ"zdy}Bq)"2:FwE"\Bk< ,!ںtOvjSD {UyH>ōe-I>9W0:ܮ'6Nq\8 $ q07F|WFE+K/-N BnI][ow)i-&IdHyl9iLI:Ճ ,l*J/A`Yҗ|v.+ŋ7_*ڼ_8;G$j~Ω=/!2O>vW3?(i<}%hS%9b I1Uj3M7TMU~)&,o*n%֫1+ڊ@06Q[5<JMR4qWE]"[^zsHa..:@%8:aisB6U9 ^k[NcFjKp\#ur$֧ 19n 3QOt`Ϙ_zro<-k%gS6:n.ݺL>U!x.M7f hv7}`ٍ@C\C&O}^.AC;S(Ss5wt|%1%˙ F83frzJ]rݹJl>2 48С%.48(5J2&gz B3@%JgRc\@RԚS RSXt Ԫ<{JZcU.))UK_!cLT8yn&.#vXٍ[2`gS]gMt$R{$/ 5BUroFqyp ߈h20g%\*Eɻu*8qϮ֕\p9mv2iSŎ}^S]{= $aFWC ,e5u{5RfiSjb\nQĎ2G*y 2427)ԥ6<h:׌ath,v!MKj: E*,O1pbbܜhLϲ('T0wmXjB> -ॱaAv238'^K6 u#p dWVv!i7y 8gT&DUxyU4nZ2?Bv eZZC:}#/Z^C]"8 wDh iL 7)RNdTOKsO>E& +5'$晁쓔aw; T S/  lxP3:D1E&߈ki)ZDNt'MY hN\7lN08N:R),eTI1.n^^( c a9%J}e'lV"4u<2џRn)mH kVFLEPԤ Kd %q{ZDjٮ9:͎iwkly.'SL'v\V &a]/S`patbIྦ0?M3|1zɃHhhq̮{n浹2'.!-Kh][|Z->^2.'Ub썜L{t$b;|ڕC3r)FRhܸeɈ2 4a{Wk')2HӫUη4u)e6@Qvcs){FRd/eJac$- B= ANԟ(8ҩxsu S&࠙IeL˜ԍ:sQ,e9#10m3($)cmx$sIm 0. cp0DLNfu̪ ]kq1A% Z:(ou!D=Ԗ Rwt@ ]p"KNT\-A1~9wO@hIq K !֖n- LXSK] yt}^ع~1#mҝ@_D.}Ӱ'2EC j7d :ӠӒu!ìL\#Z%D騎RǜHv'/mT#SvwPa9NAXKZ8ddcrHFn,a21s8n GRN]JYc@FNn9 BZnhmaM3~ដW )Df]?!hU],Nͧ*6L"H0Pu)uL2z~-|S4X23XHPx&wUP" @ЕE~]U1ԨM%M1rH[A9[VFYJ,n[8Qe]kR5 5!̦k.&rqČԘv: t.B $)"CZj[47KiCXd`DhhnM &"@8w ۨR1/,ln )K[`^{H5L4#Nr资eң{9;zqݜ"ny"8uTNA:@I%]ҌV9oNbva!Ի@a ͟OXcxk:s f*TȠn鶭) 3=&uLA,'\R0c_74ޚ/_Nml}tmʿg2ꔩ H!O[P!FyOajԦ7KeukNcAL-q*FքDnuXׯrimzOJH#Fi<O[hP q9H&!4S-Sy:d'(m5SAdJ$8$uZIZɼEݩ Pp/)aީ{PsCcagBvM<8zeR *am1.5hHxaq2qkؙ~-82)>$a & xJg3.3C'8Pt,mPd.(g67yHt'qܤb1 smh=W~^vKJw!kĆNx\JgUkWpzUsjG+EjڮmӃۮYBGjG/H6 6-6ҔA} :^^e9p7'qO2_ !l)Kf4Pycze#)sXki9NJbqQq1ù9B%)(1Yt$0L4H>c|qR װa: 'C1mvYq9Ďo4HܵqTkUq IEԪˌGܩRm8CBnމ^03$H! dr fB#$(oy|{mNiٷM 4ߍĭf5q9"I{yPܧ)Sm%L aʄnӸZ-"n6nJ}/dm J GF?hT*68'%;bNV6v* vHGGh1sz״'ZnH%?]pe uRXY4(jkZBg=Q5Z\j.m)3Ox3^aQa⟮$vv$5l x@%4T1gp@:jVڄR 6u*񜣱41b8<>IqqA$] 5H[SÐ[*T8xWG)ZZ83~֛k.@ͧDPR\qCFN ; 3X(r J>ծD4h<tMӝP#C) d=$ۤWb{Zǟ6Y).!h X:9p)"dވޟKYY^Rr 'NH+ [0˳Fe #ע;Aº0NzHw6BC-s*6Sh7! k2<eW[";ix<䖌,Dq^]lʕEL&*rwcyEҭu9-`1F iM5s^p-3rP>Q.\Gisr2"D=ƅ)4 nA!֔w) #/Z x{IĄ)Kw( *1͜p$q.^$b#(P?a:桮Hc@OZ.d4/| h9{xGq9| w!`b'½.qx'n J f vKa_\5]EBҘ5a ƪedPpQ*LtFOrʦY; ZR,]Svt@:;D nddyuMؑ>_+c67r27R6D >7֮ᡀxp\#m7kʎ\bR%ϻKӛJ BHDS/:mk˩K_NF+g1OK#v)̹%4] KmŞ+ƗoH 'lƃ/.`ğ YA!Yap<; F%LZɁj$%R SnTq1P؋Hni$*ڹYid8s4#Jƾ !%ْwa- JU[S6Z b[xhtLJ;=1ک6/I#L@_zzcpIѨ$G1ݿ44$OVTL;&!u|Rq(\T|@p՛clfMKJr70ӧL UDc&gr+iuq:k>9xL7ZmIB&6pBReՉ')El;Qʾ:cKCHb६Ki0Q2ӊl@<ՃpZ҄CB6:.2%I 9yHtD:F@U`e[9H󩪖9  vAs( $iq+p5ͥFnyc9DNUp/pᚑy{\@,$N,U €‐@iE}IKG{m@\|+E}'CBLC-JgtI'rS,AȧcuKsLnҊn\K R@2b0AB[-Q@ BZh To~ʟqxa CZyV:FaxJLRuW1qP=lTn3 \쵌Ux{h.-ЛфJv}7M$Cdd[F% +Ǚ$)hS|)[:qe 7bR$^"N0d pQo$:$n 8ӸMZ/oI=P}!HL&JuZu-&F`>Mql1BCtErb[aBr&1\Ie!cO%`Tn$Ph}F.m^cwHLNw։: ϦcyJD❍]wӯ +; W^)nj(ufdBhl[& L޽ ojƷ+E*A% g ́5@ݢG;Mՠۊ`({;dL7sCT& 9e]O I7 Rz,T'AaCXw 5C^e})cSnѭzZ[I7?ioimCDfzSYFD+,2}54G"G~/'aLx3HA=KO$BNofZ'½c< Ww9*@䙈cqb#˿zlil09{ vM 1Y_cN.(`}5ĩw Zbx-ݒTkKĉ%rT}:ըb1׵8C[-fZN!jdcl]O d&b$TTɩGvN.M½p)+\=tu@MHQ6@ 9u)W,8ДMeq❑c$qLJԕ.#4۝˞ē$k}fRh:OIB[S+4=2(v\9t* {a^DZ6 `ciIZ]`h`o))c A_RRMP!K,<4ޟT7Yy6AL8"׍ͥ9UJ jn)ZmS m$x .] s9t4yx7qNTl``B{J8SHvcږɒ`^ixzlQ-kORh2ŘDN hr݋= imkẓ@cv( թwD18#pa5\&Ifx̲p!I{ fgPOIy+J.O60Ihš鶸8:@gR6;T s>,,2t)SiHn-b(/%Jf_]9 rnb:x䄵n< x#0~Fpky>HDVs+Su2[EO;#ݥO\7MŭJm}JN0DhOdQ}c(઱ 9rYb֫i H"(t3So-D-᪚40;!*=~18sGV(n*7vͦķ{IrK۶7b+g#ˡ6@9I)FAk8ڥ[K\NQ)(|Gtq/CVLM0]F഻=2Pqa{9!MFpu'H)[znN 5npɅNZ.IE~˘zA\앆"i+(1t?N'i|])>(] &'U"C)i;1q~T).^hp`jBjJ-BkiwJaD9O4p8renaZ>R(AzyJrafԼkm](IZBp.)DBC(ئD 1CñH>Vͩs Ր&y1'G8٥h.ꨥwxPmd;=WQ#GiS8GA#׃PŻN37:|w=͛gF͒ZфV/b`7۴$$$HvPf3ZS0? l)%Ûi%6{S!jrԧFX A([*TnTf&:|*0#×oJIhl<81W)0`kT{/7eINy1= U{Jg/Xgݞ}Fw6%&6!ka1)S,Y?t(3t@HNŸi8լDoN-{%gr^F cuFYZ[>.Ī-1Kom:`۶ςw\ʍ*[pGh^_bvV:V2UzJ?LerBYSLG(6y>EN[sE l!WCM.RDkGTDN)rG%9:],q><'ƺ6)IH&^荂p)3FmC:8JɒzT^0;(o$N]*5F 4۔ [:{27’);*dShu'"h.B`[4J"[Q-21sy$3@;Rwv:Jh̟Pa&0>ʋ YLrC&lUk:(s[~"-rb宨BqSTPӜy5na p2OJr9d|Ir8J(U|cZGՖ ;Ьʚv ԺA|)v7NWv&pqm"Q [,NSGHH,nڟt,!7ړʓFŧ TQw5{?}Jqh7!v{"]$~-ʀΆ:B_c^؃ "|)2d~{2X&Zy.+ p16ƅBH_o,"gz`? F$̡Gh>3l_lʭlyDͥ[yo}k.sHHǡMԣɓpF#ʭy7Y1:,Dz֧G#5B) `tE8L!j^ꥫZd@1moF徙dDn*ԩm(7H9tퟳl翺 #{K^܁I6w UtyFK&Nӽ/?TzvU[E$uYQԐI%1/Zˋ fOeF Zbx` 6sS՞B/UO-،Fs; p.R9LӛP2U-k\#qc};[M $ecC)LXwO)4Y'C4[+F]jߗt5gƴ ! mcWh]2ދI{hcMWD`.vиd ,7O3qXyq莠3)7ɼ+h8g80qP5qD*B'cvu-]MƂ2Nk| yVVmU| _zh޾k N1(#* asn%4qS"5f-kD흱CgPyTh6ji F <$ Oq%"?7?vi)1@s{4m-y+2F"4bL.ϙD:ͥN5{A\i:Tg'FkIHi7!,x0ϕi*`ṕ- +۫|N ;@ PO>Q~D06&H\78{ӰZ9ivNhzR2k` FQnȺHy )@lBIlW'^텤0sܒ-uAAƥ:k_j8LGV4%y)%= s9좚P KNT!Ƃt~0IF` 2x /qNpi61%”^|63֞x%ads 2tA>$wpLNr2Ҕp27bޭ,Ex-!)-VL3Vu2)<'1r.Hc]"Nɵ&d|a;qUý Ec1m8e1oﬕC Сo쭶fQLRqqĞ f:1OHZeuX[5%f7S2L<8=|K::(# 앙x=%{YStMy$@'P$ZǭwMۏ<7Ҥ][h7 5_TI#~X/zpPK;9t 5g&`{GJdSVξ{ȀxɶAWЊaS~jd;V3k<F͇aTp ku)8]G yy䲠 )K&; {*r民beU,ֺ'*kDH%][eCIZm7=ֶ<\9w !{ rc NpM@@>Q R&gv憆?gkz3U9)DŴI!=IZ~)M-[ep[҈0񐒓eDLQ@m\|&┷n8L,)9]ՠ^wU ,.pDrܙ'ܾ ȝZ)nh{:oI= -ƃ[L/#r3OydD͐" +➫VL%1P;%p9Cl8 ;I@`"ўuuisSDj.LShQ N|1T~ٽeL$fA*G*dp` H(خ'"[B0C'ZKkJ[9Qݎڶ7Tt>$v,@H>Fޥ+J!1Bl2)Pb^atx&3ŵ۵Jõ6'ԸTX!tr )UH7{>yI4)~Gqh9*^0O5*bgVH]USdBm_݊, l}Vls5CTh NHl|:Fq Bp!o*_24YxV\2q08>/z?%Ⱁ/>ծSF6OZ AFY% ÊfIhdڛMw24;սG!BNlFCNe&UK`4 'RTvX$ O2ezIx8tjXCH],3 h%닱 m ͭ)9ŭ9flicԓ oz66Q3P݈7}cZ:Kp!-/ҡ #C֕'%^lJy0p Ü2FjGd/Q |QDρA5DnSҷmN֍ $q[ v:|)div^R[K/Ԓf9GCBr{:98#SgcGYQsn !Ih ;œøB7􀁔\-v̒xqSY6E*-')=AG{\q!INmjt2(S$qu'p0Au}G7׎CXoqKMWl78wO:LST+pU"![P0Q;'lҽs@*bQ t́Ҡ *~#E ,#pa9,ZFl)dp{M(,9/pw%68M\MR0h-l.xv4 Tmi#ɏ30v_"{ɒh(|lc9'=zʯ7'GpCC) c>*FlѧbÓDp:$썻oC.84eMmZѶEi[קqjN[M|oZZYppeةXpn`);V gMQrݗ/02΅"Ӽ(z,^AkNнlaq& WSL,쉦BOIJ\eZGeĴdَd!w{p:P[6*brĴk#!֒uާu>u"4uUS6p~; yƲB($7^N$=w;*|eFF)V{ M[\ջ`/#QU-vD隙4F#d3Rp03-X~h JM CҶWc9.H˵kG!@;@-qTnҽ፦\ڀ.zm]u. ip vvD~AAZ.}=haԪ4d|I8 aJ`,3W&ɂFC=*ZqJN#hҥPG]Kzuxxt-o˚a#ݩ)mѹ 7wH&ciԬpRkmE"|l!²&J ܼ/3 vlDl;BռPF\vNݒ灞g,Ծֻw*\շ} KvY@OGZ(*3'a"aL/Nk'eĔrA$5)ڎO9({75"2#¤o)Xsd:D/Y,%in)7 dt-y97] ިJ2AgU[c4 j]RZw@R7kL K8xK5\*RxúO{hNI7ByeJCn> [[˪y"te'P<7s(սeqiKFRF[lzU^h%{g Oapcxh6蒣`ZNOk|v&< h;TNB7)M+̂2 ڛRӵKfB7j=o06(a#6SsZ@qlH?ٙN;򄸉qeۥG,mT 7:UYs]}$"냜-++vc@kD!7dqʆ6pFxyU^ kUw) }']v&Vz]MǼ7[wUXDkKkegI}^Fu8'›c Cd[FG8ZF51GoJcoUgrԪsw˵޿{dA A;w:u:9ù6T<Рo Qo%Y^m|:bHh5n0:*H)/ V/e_;\pLX2^Si<3d-XSO`n{^ݵȔsD 5fj59&6E{3"Nl^&Ic\(4zǃfl6`CV>6些Sot{5Mė` X:QΦLpFvl`) &wyy&yK/3GBB֟;p0K34tM۰CUAҕnuL8\: c%\RAՄI\g?ic=KX Vb<-Nd M^t[]qNFAxW4pe(v2ܗ8u$Ӧ:9 ?({M*|v"Gh. pyȜw95ZK#hGlhTb;֔۫;f:e0!L*A@n$C'; Ad<-Bl1[(2C -fia;%k$b|H}(.qJlksT!Ȍħ)SuAHH tkF$>:\Z`)䄵6'0|.1,GrZkZzhl۰4N"-k: دFsD:2)ݩmPĈ.a2՞c7ôXL#Olr(IKjy*F߹=rA  kE8i'J6# 쎭;f6& H.$uIa{InqTN쑬kZeӄs'҂Nu\r&zCA$1GFs Akԙi S0K^])J/ i|Y 4nP Pca꤂\M+".HH8r^ɦt>B- '@S.ZvI]0@ 6vM{SO9^ܗ5w(⤙I (/bez'cnTڴӌFNvR}Wq=uȱeEI;Kcc _ Pg5> oVr L^{iu<VLr/lp'#7N gasr:sin-0sϥj=:6iPuƚ AP1̮&+]d x g$sNY([Hqȏ*OpnԵ{j:AS[*mBITG]VRXЪq } ʇy[YVհ kA탘ձǤJ-X)",~x863|5,!0[LuvSvroF3Y5~;?:8 ꄺFUdޤiÙZA)U[jZ&Lt N AσC9%?юvi-ƺF[֛iӥBlPg3J6~Է<g#എ辣hX35@3kFm"37:[%~NɱQDx; Ei6CZ4k쨽UYYmtH2Gu;0y@L}(lZ2O8/klv;.-FJoqQ}NqwUm+$!W&(KB;͒D6pA+U.D&˳2x;AV^4; \.dOfD:D~s\9ڮ2|0QY,?s=J-ˇ暴T&-ŷ1Vv t6rrtTѭ1lMz8ev}ZCeHԈQk^1ԉa}O.4w2 p DH⣒XڕL+1БhU;0vrEV/4z8MK qE褢t1O93.VLh8"+PL ~>!LҐ pV[ޠsSyKeh;8lVz馧lnw45znж C8`:'FEӽ7_H 92E3㾉=VSh{C nCpP;0vUi ;J#m_\vhS#9@sH YPoJh/"@˙f ndiRc<@Ԍ{6-^d) h"[1QFN4~UnIp=hfFN#=3[IMɖLT3,І;Ai﫼]]`kA>t'k1 $ Q6[6ྜྷ&:A ☴˺p9k $4b1 _"MϠX4FvQp<2M3:)2R1Tp.YAvUij1Ӑ&rwe[KvxquR[OmSĴ3 *6Xg9R9k_+L^48@#ǂ_ K#4sq)T85Bϼj+4}uL,95Y+QoP0fS9h+]¯dlG^ܤb$7FamHt) . :8f .m+vC :Nm+ 5(Ь}'H:'cN*B\#Z,GcZPD6K|o~ڄ*d4j8\ ]ru[ԃT>_ɫ.9dӀjRr' ѿOa")3)38N} }حwdz? <<eo[u9?PT 8naBv)`ԅ!=e ˛zcÚdGd#l:Za;@h7“{[C)NhψCy$)Xcfq~N`Iһ&gayzy?$wu/d&U+ +ϠƐZxky}Gge - N"T}zMI'L]ͫo >YdWA ׳(#eQ>:&'+MI uRޔ0$C0ZKNw-&j־u:Id[~ϿҢ]LGGWcXLZ\^͋*<'hl__?5p|T7 <9&X Ia6]qR`k}՘$@ tZд kIp"cƷ7 ; FFNy= [sCiûg|CKV6W9lF'/SJP| T{o`aib>BڽfVRڕZ `p7ؘ;%,>f}UGksx+~@HR]L$ۘJ#<+Hq{ʄ33[Nͮakim eZiVo+ٚv"\$Ώ`{e)- +Yp(qEֆ2>L0 u r񬖀sֳn85XY0EƁeO1 $7T$sd&xs7GHrjs[MXLe1<40=c+3Vm8̆|@\[>haloDי=ɜq--!t/4A;cVv` >pӶ4 S`]*8kM/񶽕&wOrG2 :p4!բo$%V@EP;iKyxhmUN uhR}^6*,.x%Hzf k8<L*"?O :KQ) tu(t:y,e3pN`-kR!1W0#to]'AR\r(-Pm:=(1Hfj<< ߮a7i|ii9'nVE5gSYǴܒ!ru iS.}ˁ;ݯyh@Qgu7U-3 gr6Q\ˉ!X&W{qjl[vAErMW\UҿL>)̡!ݥ<#]7]6BإW{}@qa9^zC6sOST}ŕ{;LfFdIS6fk`TkZ]\ 4Xy 2R[gB/P ll4CxV WN5MJ+fgk5np ~W:ڴ9ḣFw{ gywmל*HȘ֪眞y8p*Y'v$vrJG꼝GGVh]ɊGy5E:MltyY mQ /"Jbҹ'BNkSkYhߚetqRp694H2!8d0 @Qt#S'4]J,nj8@EȐXT/$A0/[2 5hULLӆ=jlM59pq:!&fyL9+y_yQf 8#vEJg4I7eҦ1~XhJT`\qT y/rr$MڎZ.c/*ˊe"7a-u t,'ιcd Ӵkƌz9 n ):(\-mHN^bsijx3r.`{csY+ʮhp cb/7DTjOD k`h=(Rju)eԜ (VOgon;+lqrf1=Tb3ӫrweI"'Uv;cLĸڢ9ŮqRi(8ή^j`w11ԡJ\9ܥml$NLɩK~s  љή%8HkYG 9v q$;QyEƝcpCI,kdw->(]rT퍜y8i<@^ )HJg _ iסK9D\9_YR9Q.@&f)X[hxd([A5J_c*$'c"hx܇ٕWhFN2UfF5Y?0nhYi[' {x"(Fiڴ%ĝ`Z+v7:pDʹ.ifg"CiRx:*8ܤUò)sG''7Q^$]HQ.v8 :[ "PǮ{G sFvٶsR]"r-փg`j# % x⟈ዼQZnkKq% =40lO|[;'Z -{ĥ+z2%2 ]"c7}A2cMlZ-@4#8^ ׮k(P=ĔC\R&` TwmGf8MgVk3Q;,S _L,-mՔ%зnTRފt׽pX-qx㻹ȫ;I^oo~.rvtgZK蕫\z%~@ҶhtxMB<,cM< E }%>+R/)~:qdC[:j mf[ ѣ3K{$'$=_Q$ "=@Cmx7`ct9)%્_({LHr[2 "v-֎-;5VnN?M1oNfm8*Ƀsu_ NFq|/H}LX0A,%4a&HlZڍ-{MEA#IW֪=!BU/ÿ%lϡ _E>3u\ed}wóz7.x!ɢKhMk6Om(G>QN CgBkc ȊUdXn7kXDGU # 8txH$;T-; 68@w~&&&7iRALGxx-6.X8ec4Y.k U5-m cQ; ҡ^8&IȌXۖUqN̙Z:`h5-1F0D|_= sW }) ycq$4m}xO67A,Yv_X/D(HG^nLjW+i\8=Zck۷clZH̅]6wt9 {k 32i.4yݒZ1HN|"AR `5n];U[y>lFr2vZGe:X+޸OZ1|߱!p-!ڢ]p }m8T9hFv\ ѦU&;ch>3Tn}R6"Pi]c k*xA}XWNkذudx8S{li0*]եV$xUeR!$7OOmsk1OKGT}/F~mc4OsDETfh,x"rX}LI,OW;{ֵ8/_S1v5׬W >l4#5Y-md D U@:5F֟_;O[s{};/F!_!^,icyW4"qtU8߈cYrg=< YDut*oE;NJG]^r=0ju~>}6wdg |isÂ!vz< [#e뀖}a~ sތćtr)S2Uxe74ik .}$VmejBڻpS4Ž2bY:8ǘ b69nTu;;uzü#X&0DrfٔU8 ωqXSeGp>r[ӫ&On\4BS>Z17dQJ[#Oq~+"?Xwlypzn3 lۚoi$)+Y@{cENٳs6)s*"DUTەeNPuw h5K__UCxihWGaGX0b+TǤeO刊^{fеu'2'x8Xq|@tzż^CzӁ]Ԇt[/ '9…Au苶0V3TbrHe0x#ys/X})<rX= `rd&Y+#Y'7 W]6[4UgT%0Cv Jk#\,J:XG%'Zeu K3?Ga%%z.n4W(MS 1\0-m-ok :zUY:{u[YiUZsScj$g){|p9O=^ Xp]кWNRf'7%WZ>~xUZg?dl2-V\X6Wy9GQ/]<9T,'(73݇tG5!Cr` G h. _ћ+`}LJ̘{ ʮ︨nE#!){q#㳔݃u0#  DW> =v?AcӪː+ =jS1nmx"1hmӣ#>G_8Y$]Fm2y(EkYZBb3 T]Zk UNNN};| n"IiqEϬ׼9L^Kp 3݃t1t+)Vݵ2%cA#,z*m-h4OYrG?.AL=oFbqAz# .T,. r NwԤ洖7OU*w9g8'ѯG04d FMeⓩTkh\7J &gz¼0~7?Y 2=w-g*G`y0Kn[BjbެA9{88m o1ftPVv妝-.RmeF8( g 4G%b5 |F:X+޸D.NEɼ XXc2n-] h'jUsS{VFzM.{enk9AYE/OfwPT}spk1T{^KL+ endstream endobj 49 0 obj <> endobj 25 0 obj <>stream HWmon a>@̈{^r沸=bSJD;d)+^؊+Z>u8$řyfjT.~%0Xj=LCE*a$c%*vy~{jE\PvNm{ݓ T@DKYȈwa սgc"‚X4V?a-X,KEBs ͇.]i4MіwD^3P~1U휭 ȸgj ^nu+ uU;j mѝnY, ^v*WFRьU$@J~$Hـd=?=ro2lE&Eˮm9κ^["9gM$)ԵSM~UETd6?4 4l08ޱ1o-{_!Aӽ ޻/&ܱŽcH `ɮլm/& cW)va|huswfqAjDzWl&׀e..^?l_p~2XRy>W0Lk SB X"2v V.ݔ({mkѤݙ"c٠) inc\' v fHNWnD c[ulI\vY}n12.O Qd sz6C Z  rM@({@.^0F€-S HㅺAiPt_=#>Mxz êE`wXρde&}; |P1` ԖON@dCɚg-_h#>"5pVkAzC99ۓ+#B|'$##ϓC==pzk9/[ٰ3n0 ܂JfoNx!Kwi@zl d m+0>O$='m|ƇS0@e& ӚJAE ʞl';4`gђnI^_r8]I!Az/\L$(nshϽ,9ʢm }k/Դ f#Ȱ I<3[h.N}0˦e2(P C{Xn~q[,Cc9Ȧ'J*`>} <,e9=c ʽz\(2I1c4ٯXn0SR(H ibD2m/) @ 2C(@#Co2܁O{pHW2Jbˬ~gXpJah8?#rojHإfy%p# 윓ONed\'Le4۹B!j ڔ4"dr]5g$ز>rv;Xm@ )1A簁;! mR )YyhkP3l|k`D9ؔ c{Ht_豜u>Cr%πhJ\w>m5K88M oD/8h=}sĞIǟ[f }~F.j;> endobj 28 0 obj <>>>/Subtype/Form>>stream 0 0 0 1 K 6 w 10 M 0 j 0 J []0 d /GS0 gs q 1 0 0 1 566.9293 54.8673 cm 0 0 m -538.583 0 l S Q endstream endobj 29 0 obj <>stream Adobed                h""   k!1A"QaBq#2$&CRcr %34STbds'()*56789:DEFGHIJUVWXYZefghijtuvwxyz  m!1Q"Aa2q#BR3bcr$CS %6Ds&'()*45789:EFGHIJTUVWXYZdefghijtuvwxyz?!RLdo% i*Cy&+ո lgFlCf8"KRJb)X"[¡U u&:,0dR Ch!C5^.Tݔ#=::P 1JÇcç 0Apav:7LEez[kalho8y!)4DLhuVA,;qT<4z}fPG*8 q[ zHJmKJoh3N=-y7q \3WXqH^];yUF<##^ B^dW1~j|>j r?<}b:ơzE!J WA}٦>yJwiGI1jP qS>eRKL[;k&J xВ3޾mKQ6~.="bJqJKN$ ѥ,9?1la ]gVS%d@H*#]`iZvLdA1' ̢pP綰.Rs8PS0|Lht0LYbCEq!slWl I‚D@FYH: ~Ȗ^hZb˨6 2+wjK;)HIfmJ P|,y4[3 q=5=Z9 P&$J$yN;ݫG)Cm$*!)@~ e&B`=yz&Kh+?"p&sWoBubخ0$c#0+OZ8CXRx4+ʓ5^֘YE'+8WcFxѪվϽN}ҝUiσJ`y^bqݹϭܪtt:i1FJq@V4Ž # 6k(-V`nɡBhtQ흢en5K<*Ir Nnz͐TW Bp Q "0ko]`>k\!SOaLkRP #4EҼa]1MB{D[M0箟2:9U2 C:+AU:M.z<}t&nQҫ\O ţD |ح!>jO<.Nm/4,#i5>j87$Gw[F x ()"޵$RR@ \3-ךTjX{kMo+=1kG[H@8*LKģNf 'Mi6B6-|cZR.#圲)5 ir++ȑ5]Gv5fd ³ܶmJxH%DH%ʌBt+L]Gu5h L4ˈ;*.FJZ7okGW\_Q˹.}|hDb AIH&{wWjxFMviq͈cp]H){rU d=e2=|y*|m?"'018gȤ'6}"<=ZTyV}W 6y?Y39,: ߇#wbv N=mxזjU T̲Jㆊu+((UNʜ" {ĊN *rփx<%6}[|zF9UN^v6}E 24 ݞ "I,ijT@(]6ͦv+OHZbBWu(X6PbAg: o4SQlہeXZ`۶J$ Dl2xV\,vbqm]]LΓO3I(f<6 ;𫿀@'c Ͳ5-֡x%GL$-PmerLQϧҩcxb2 ˎnTPH)Ŝ%ĕy%5ke'3dEtwm-R,؟'D88F$ ݥEMёZtr#OnOHA)q)d2 ,lmP얊o Y-)P}{GP}>Zr5 ؉:ZD U+`ޠy.$F]% w&$av'\Mۗo< a#2DI&Ժ|YQ:BT)O:/UrBOP_e 2O+J۔ZRN tDZNRJ[ G@Cю`JRO-N7OJSف?D+b5^$R4oNrYpΌϽB;lOO1}6c&SLF)ČM|FMZ1#yJ+O&OQP>|b#B  r%#E6 nv󡺲2 unTJ.r1p"v-UO6J\D9hyjO ;ZR=ʅ v\&#=5 *MS户\>dS6G"yJO+̎.y L@<WA<*7/F^_wVUu_$3>0FjGɼ'(F5dR`fJbJ^Ͻl輦@w\8?4Dr%n!GZ>$Ez \ӮҮ# % v6Б#" l>(˺Rm邮՝D7Pt58[7}5"J*Q<|uDxqh(V[>Rut)@H5t$ɦN&&{+!Kz\Fhn6)rUu:f.:oQš&DV E҈:IJRN\u+F^Hh %/K n ^e1|n j8  ;M| 6W* $Ȯ#Z:W;ufRg1# ¯\)"*D\,:oa0eA/<>6T&)u#+4碭\!m[NaUFb_V^Xű'avR(7G:"5\ZwI&ppk_1V5M^̈́Xm_3~R~>ug6 eOi.+o{U:jde _PTWa8K,߃(PĈu -D6``vJS`F ^6vRhBqU@ѧ* ڲך}^J ;D09[LҞPگXKf;i=l’uP4*̢TIV^&H;cR~ MJ-F@gz)c46:<I#ݯ*Ou"tg$i+;E{:N[rd|eKLA6*HcD@v=ZIJT">y?e؀B4l8O`%1 ͢K:F%KR.ITRS^n$" Y'*dmQvi}t-g*RU'HՆ߾f.-j*P'RS)&(cTu zwܘo&8%mQ R{tAi.I.NNY'Szj; G\*Vt>֥,Kd_z/;1V}}HN}9͉/^GcI2>j=#o}ꄺx1FzE}xFО^ӗntdY(Of &RV n]R?db1gn)2ЩN($`h54!+OMt̉ҹE<)>+A#N*wvܪ^ x R%Q䮜6rQ)mf2Uy\M6PͳjڼQˉ$O/8; 4(&mp$HY9{ZQJH6 s8!xH7 [j*HӏDHcwIsMnAhW(6Бui;ML^XM>u~saeP-J!Sٕ{3 Ga I!*?ZY7qҶZQЅy@jaT@9k~ğ yj2vGaֺuy!$*Ѻת3uPb:orXTiP"G&$߄{,/!,}bF|(oEs'g4 ])wfR*Ygv?].Ӕ>zqY/7Jv#kIax>Ts^B[AWKtE*vi+Y樋wR2a\Oi*l(j.2R$`bl$;H "unlz{|(A) >֧i}7*Ѝ5$&S`D 07ؤ,͂uThM@]i42+BO *3-k,h:'0fN- lFC8|'wդ'Zp'L` W*.$iUle(oóLnWfK-: JdA*e'i J hJmO'UhvR#7'ߩq{$_ī(_qapr:ҊVD;Su=qe &v҆9iMFIimJdAqYM'zMkZ'ORRnA)lIA:q|HpT}ʴ>r MToVJͶ]Q$mTKJ o.(%#ɯMTʚN|_7ե۵M59W~Kx4ea(myU99iZn2=؇-ӍOKKf%*Pm ޓ'`8-@Ni.4n-߭qyȨ: <-]SK“Ӻ8=.W JP)3!e9I)V153̃_ xׇj\-[= GTRу*ylU.d fֺ&\ͷcڳZHH ]#V?5gp}m9A%(9 .nm9f'%ѩ 'ʝq e'g^)"]KRT6@ΰkFQ9<쬀qb-u l)(R)lyBE+*M.g<7B]G#? bXp {5úGܞ_={ݫ+U6ͣx4(H<"}kGmiݾe*uaMԭ]QpKY%9r+^e*|$ex$uϩ H+^Dق2"Vr'IzrKxYDG]ymin_Xmju=' ]h . 053b|Euc2Z !:@܉@/aϩRS%&e OOel؍.za;!-SVZ' ,M-$nL(UP)lS ؖ'qSUE&Aifyl8A|>aéU x Rb[>zQ+w'o{yku]Vo{U&>5#wv~3QA]q;̷DQϠ)=[6Jfǭ$}`P毛g Hش7%}*~,0 SuQ5ba++a62 zt[@ͽ-1P j.ڹ ~dt6&y*k &tlӋNH*Zkmp RA:+5$qBHy'qԮ@&@h'*o8V~UE[ p P VWb% '#kXq˘어 aWLԁֶ. PT2΄<:gϺbb1Rf@K'.0vP,BM#'JC <yTՑqT~)JS_q\aI}>;Y&hJnlݺzIHuEI31,-1۰R|  ^2Sd dFi4rqsI5TסdoOm#@>i`Lɯ+9 Dz"vp5- mD-r^Su:)9v}ErR*BY@h7{HJY*qܙUF)]sSUԛSx,|z&U,cXr]%rt0!&tKMKaWBXKjxܭ的]jΦA]So C8ќ} ;!#U.'\݅6J[Ex:vޭi&Uyc%4TpyB]Jɫ0GFhNG]RZ2 =x}7{`˒i d%)X$l EFgm(iYp2"ec-=.m@ +;B֟,GV۫{f:LKgfn6.u* MX%M3Ttޜ~weo.yr$댼+E +Q{hHJRJ`6Ӿ맸 =tT`JTƙ'&] (.2^ǝʽI QܭBQGYtPoNMnhhWꊒnhJ2jD_<^%%0I_[!Ɣ3~3<Pm$:Lmڞc#n;(崨E?on'rqsfB YRTV&U'H2#žb0<%@gl.#ܭ7P"v 2%E*RM< ajDC!}DS:!yY˼J]Xٱ iIʑPXm@*W6+5IOi0u穀P([ /. zФ@A `3xVi \-*:U_ qX~(W+otXvE̍b~Z)U)Cv QZT} ],40,e5wѯafC.Bs*B{KQQ~5k*,+{Tmt<eYGMrDfNo;2_vMٸ[%W*t 5@l@KrtMJao`A˯77$ۨH! ECjp; [K w\rԛ.+dJ/TLٮP K2X*@IvhF{UvyQA*$'ܢ .Zq[g2õVy |Z./FpCk9v鯻M[X9&~BaR\l#MZ`.,f-gY<)uo,9ȱ)J}<moN]Q\FDyJ5E-x@y}7Z0v}4~ڟjBx]ل9-vF'p90~-մ<bs~/ 0=,k1%>e єwtEJ`e;Hu77Fs_KčöPߨ{dΏL޼zmYkMs/enV7nӭG[*}sj<-8"ݢ랬IH(woGSEbHd Shi7v^ 7 "{I7Z92HF"ڵXԠҏ4fMQt&~ O6Df5iڌ8C;p)oZ) )ʲP:@k#Fw`mX6Y\j.f{iW(rX^8O>+)PA=jH-a;:{kٷKKߵLL&֐֣o2WeW( d$iN o7M%)I~d5va< in& 9֬HNћji߭]B.BZ N@D{^_4s8ٌ҆S CD"bP)Yj6t#V.Fi6 N#Kʹ! qcL[-f}Q&yR]3 0ݥ[+qaJ ZH'@8ի|`*JAC0d fu "u$Fm%$HBn/#Wo@MLE ]׏HxKUyASҨ>I"O "tGSH^knfL+{VP׶Du9]./|Nd '*H.6U\%ҿ Udu!+ =C)& wUxᨘd B[!#eH MaԦTξE]P]ST:^V+te>JPP(!fi(_,T8_Q˹̲X;h))hw*%(A( $vo1{CW2- % Ę, -lliIBti5Ӥk#' jDO:KJSs3&,vP2iRF逹ڤ=eСf^mD "5- 4.&[@ua 9RO< n[I*Tɞcj0whr=jRJqL1Ŏ.ÖJZ T=LϷ2i Jn=ڄXZ'efWr'7+e߁]59bfIw:.PA؊V. q.%]/pRO_l5hDNk>8 \)k9&A&,qDOFM$=l5Am%A'$C, )Ys)&]D })F[dz@4xVUc!iZ3[РHPҤx['&bLOʇ z$V*=Tz[KqkBCq*I92ҲI ƉU*tjh!n+d3F |B\K-4e)+JLuEE9S"~lBMͲ-2>  FkJR#tT8oRЬ:jMRʿ⒔%Ck_=`j9l'%vVjbIԔxVҺ^ӧ$,\ds.o}MحN wmQ C , A!"H&,Cc|%4- ͲG:ثb8}*JԦGtGĸ%\]k-+)$O!EaD>uu@ono*PV;iMN2~A7!(\!%!N7$LS {"Ԡ$qéϕ19{i,N%A>Gܪˉ{lʛ?D'3t04`xKkr*'Nh<%NK^ vV ֳ*r J@E?-xL0P 'R(/,dDq%i؋F ĵguPIRc\ܪ\u qD;m/a.+KaCM0dv\yKw#fΏmw!״Ӊl`&"&#KRݾ ͳm )uHԨ, -udi;i%quRm!$ V3L3P[f!sE.IIV'bLzTx]e-{gB ph],B$SK~6iDS%Vic#` j4%'T If*{6c5"L_΂6|lE85u͉KRIV kh\$[A5iFd$@i%6TR6=XRz;MNa t)*Gh}SCmwE-pH~ca` r(a7/g #e'Z}GKKᗗp]wuIhF%$)F@FNO\Wp鞱\n\gL];טiVRA :#I§ؾjf5gl.aVۄ-氫-n"C5Xʹ6CXHf=)K H쁵iC-HyHΧ\R{*̲I7|(4\B s۫-j4q0FU3GKx);c0ToR|*((#d`{72RI/T<[FVZr"Xx咵R*nM\KLl!@br7lj(e,R;A\*LlaA!۳r(Df& Vl归:OkhI=jڒH##Uxű 6mxEOXhZ VԵ$ZT ͵=Wk֜<yΚxׅs%] ]X L3'ho0Mm9nRZR[i)'3a^A:uQG_8 ܸK\ )$ZE]9ٙ6$_0 q@ B)gڭ5BW\qR ^n[J-Ri;tPݫ7I+Upp28mapg0q IfuhMbӘ! QSz M8^.m^iJ!HC”];ӜW`&TRrTP=*uld^۷BlI*m@q\*T4쁙*P4J̳Ҕ h ,5 [4{'Ezg8dG5֦XyboaMV{YH cS_[9.MA}|qH) T8\VBp胖NnwФHZl"%F++d%ړ#mnEbii?,V"' $MvbF)s+qhUw2AB37rb*E9婋'78YV9y+]^]C @iz)P\RVLdS-רL %~x+>KUlJ@j΍4jıK,+8v ChJJDB@0UT߉v% @qyeYTPҀ:'SFxc=4[U\S&y$ 0ތ7K##%'e=[H[R a.iy Pb9GNSdl!7)ٶuh\:BV*Tw<ا!OleS44T- CujƸwn+B%aKYܑ*"0|mVvi'+% lV&1 w(*RPr ̐I2""u>6s[AۗT J2#rj#Xs(~KĬ\\^qMXdB84vJ{i1h$L/AkDxae{Q۩Io!IhQ#mG} uAH*'FX}[ n &b91D/[<5. ĝ=m rb/6FHPu9eR!"}=seEHaۑ9$DOip]i [P]s2-lŕ)Cl;kbT!SRa7L.R ~ !+Q /0زRNJeE%ط;2onx`֔'0R\54Se%=6KE!y-$p׉)r{_cUI M1PrIKm[ChjwRDHQȑ0BKZVsq KPJuchɫ3.4e0@aVJۄ%3$mPV"6% I"dlh%I4Wbi'd_„%-LRFNf<`aɹ֓e67[L II+|YÎ5sq\غXwҀܓufYq+ONdC0&: H :M`n!g[vD9^3cݤpbH }Vڧ, 8@I)X91xV1snF5J}( mw(I4m痴P;+WOo8 %1A"}-1)Knt.:VkEs}I-6M"׉AR&mO'ā g5w^@P .6A ԋi{{HԵPWU 3÷+t Jj/K{3,AuCDp2&% cqu*J+6v9", '+Ya:%a  hֺNE5%d6#B̖!7:}m{.{jRR\OjuۍWi7|3tUqkգ.RvH'04\b8()mn.6HH}/w؏q=b-nA̅|Љ܉4|:}!\}+mIPybx .u2}MFД:QQIܺv^p RPIKM;.06mq/*VnӉT+#pFeW6CZ ~hfI$U a[7MZmoHP gJ]!`lul^[˶=ٶ@3&'Ƴ69,-PWtA@$Q*μ&et.#!S+SJNj'()94IUiCfEJ=Agi3&qSǯ]JSqfV*5w%sl-Vt%G2YOm${0go i,! f0'Ɓ0,50 o/. hB{;s}岬1KTmdx+EqM*ҳIpJ$.鴶$h<@#Qe&ܙT+y i}$zƲS*BrU8*nMEkZ0ZRO>6sٗ\-nS!idh*X@>?we!k@)Lqc`!WI. vԓ;T1{R(zEr%9:!&iƥޙP-=8hn7jy' VGv7۫ A1t!n\ AK*@',E%J D{Jmļ#jll{uptwm)}[apJ|-YJZJI̴<UZS9J(g&`6nu0ɜ$J>@+ׇ!%)K"X{lS_:ܜbmֈ HPDS]wjg"ú1 `:--cȎ{;MmL6j]Cr庮lx -Hk[bM,5>oZ_jlV;7Ign q]JR+*M}vwyE#])YpZW3RʚEfU,iu #޴$MV Se6R[\fP=(69A$m؃ O3PuhA? ZsxJ$oS--Nvtd"O5ٿfmT f] YJ@*O+J#=bNTf'R=(Uѧk)v#c2s gjKvURB P-w̅H,pv2NdѸfY9qGqX;cVnmK 22%MFk;,9hgJg'\ْ)|UҽxV5ǾiyuM/WU(+TvszVvi* @ )8E,6Bʑ0O'n]h Rwm X:(y;uÖW¥TT@'ycޫ a8 ئ݆.Q}+}ĥe]tZ#Q1 `#ߣ>𝪯m5q/8piŬ57Ti-7K8<v%Dmi'tO9%^>IQT0K[0UY]vHNAA6WcJ;,AYqK!Էۧ.ԝL<,f/Z'O\o=ϪJ=4pGƘ2ۖLe!bU6rHQ^ b]`8ZҞ6Η8ڔCn>Te.*y_[v@ksP2LU{apSsshzܥ [Sz–'P4'R fR^@:X oMJ$"1;NJ3,K[k T`q5xB%jshBЄLSQ ߈5wrݢ+#Dw$lS%V_I#[`xn;Y yXIZ3$JyURXSʕAY&Xok[\W SO1pmSrPJPl찴i RXO%=*m֝u,ih%@ꅃ) OJrS2f-mWZ4j-ㄼ#R6Ͻ$]:NR)JwiIG;<6)j-nei+u S֩ $N>4TS/qVm-RBTJT!$+R}N4:ћt;%ӻ6EbXzOwzBe!e̥G*`MxiZU +i(X|(F1I}1 [.eH}_*Rܴ`/䕝܁|/8(Q,;7.#KS qrǩJwթ+6@w׋wZUn۩Z9uۡ6@$𜱡=*s<@vfNhwzՍ7&R9T z.3! bq ,: )rMu%# 8t@#zn^p拍aL5+}@$|4(cl=߭Un3%3(1ݸJXnr$w ${%o=i>PZDyZ0lj!)=q!aE{qVv3)GyaA PGDaױ̥W=Ok;(S<5̲VjSKl&e } yzV(n5JM[ݲaKP4((8;g: S"NiHh5*X4ILڦM["ODHd& L ڜP k j*܏=n -5I>Qp[IZ6O+I?;BЧV%KPH0_6:*Z@I=9Yƚ9$ۮġ R` CH"o]gʮ LTaT6J]T $(WkLFb"}×ոSy1>3-!0l?vAAIyJE&i ױ,.,zbK tD_aw%xv&;ΚWr&ZOgՌt3[rOz(z#j6sh76"َb%Gvil@|MmsAT*%%u'/)Xr,/m<:8@kHIECTSKnBԄBȕ$L1Ρ8.,\=S֯d>R(hh)Ck IޢRqS)QmUݑyP4Fq*1ݍN7UJ^iJ==l6jmit[RTdH-$zBA;$@si)[k̝}E퀐iK|/ySeq-!T6YHB[oGaJS{! !S%?1,W,H) 2#Cձkj]7Oh0@҂ҹli UeS)Mcpf(;nau+PA;3Fn[CeGKgTII"ez-q K1 dࢠK0V2BhU iļD* V_)JmJδRgLR;!"Iӄ[b)ZI$^ qY 'pRҭ;(8֫BB$ZR=nH.'#QV8c0{5b T@N0TpzůܿKk )N- 9rFi[QvZ>47ˡ IR:q3T B) Dp#4gasc0@$#NBQ#YT3IoHK޵Ρ?RxN٫cuƔ(eƔhs(uR؃q]D XW6yX)M=zZ+( OL ۖjBundtARq%+%<۞t!P;IANJkj 9ږ dkTvRqJHˡ=ߑ磼Iq&Kyg#e[cؠR`i&*weE.2 lcl}ҭV̅ⓖ O*1%qPs{) GOMmV%[mCw2ع6Y-vFpeIle u#h2vQ,,:p]!J$RvR}AJi:Z䱜-!n!$dzWfU]%fwO<Ӌ@Ip Y \A!),%g\$U( SUkĢӳgXX,sO^}T5*c~k[oZJ;>j+1 %5ڱpN*RˇT` (,$wMgL.V:gdA PJ;7pzʘt$:ʺ):{U ZitZO`E f4ma eR֏VOQU#1<ܾGtuI]M wDa Ի  RאO ykzjy+)kݩmnʰvzS4i: VB,n0Uη@Je @HQlu'ap8*̂,?Tz*m)!HWZAH"NQL>2EK%妜pK12DfeYknvW0\)- ՟Rrhx&;15= V8rPuŸ@ $ԏZ< e q׬tԄv.[$rd5!Kxf/]Us \6~7!+l 4{%ARV I#xr}BC4ͬ H+i 5ms#()ԓt(_PMMO슶R  Bj-Nv>e)JHJlI9فX3 @ q`$XXXu<<{Pը g+Yk* V-EKHPi5~p69nRHVg P2'QFA%Eו|*iRMղlnŦ R!M5lxO*0҈Rr)):܀R| =kp&qD< Vص)ӕ z ;J !%ÔQz/q{u42DhyT~Ē۶0)@K)TS[9rRӨ;O%6BR9g *HZjY.m(YyG$( S.́vT;.NcWc4T6퀾D[Q ա}}PeY)W~>=AQ kbILYh,hy6;񫞽 % uJ^p)\;Yb Q= U_6mPո))KR*̵gTB4_On}3e@ݥ9hI&:࿆q&VX (.@&M$"Kl~Q O'ɤ-fɸPA"PIHɔLjM zyBԚ1S*LkC+Z,c9'yi˛~:!{ H9q'+tVڪ6%m4qHtC9)ujxJHROi &G+k`0kEV1H4Tt´w^u«9Ҡwa)#΄[܌OxL~6n( WB4o`z"/Z΃ChfL2MEc*.<^Sb)\5OM5⶯m Ďr)[$oSU[]!L)ByMJl#;H:_p޸5t DSDk?է G"8^e/8敓nP2JܩeF[?#]63N.mo[\uNQpP<bvkdAǵ:#uKP`Sm$vzT/nIj;)3VܤMu\{(xpŬuXܐ@+Pg4$T`Bܼyya4 P*I4,X촯0]9N +T BExy7JB6lykߋ*-<£+, iBCshBBseBsV^'iY]D4Ă|hSŸqM_)f4CZQ^Fe!R+ O`S7!ex,^7HnRe6_ucbqpAIʝ{Eb)yEc7I2՟s[ޡ+jJڜL * *ҼK :F5;%(.b^_|he S.r]"ۼ]O ùK}BE7SbҢӮ :Hn!r$(hFW8؅k.!$GTN3_b\b QxH# N;FZz1?("Qn ȩt..Ew+ fΘ$R5l:fu4xuMy`tF+`--,e.*,ʵUKjUL=0Xȭ6BTu)P7 * ,EаVRlxe w EO-B@JM P0;sgY)KjœutuKqt&tsy8.Zή ٵ$hri1CKI\R`f:w-2 r.3u0Zi!WpQV~ZAM3 ք-:(d.gދ\!4S, R&IML\=hN3ޘiYqC-.f3qp;54cRA˓k9nY5`Mͭr]J֠PdDƤ̊.U+3nPgAJTuβFdUE+SYHQ 1TD€`oZvvt 2b 5FUvVeiIX I""̾okC-[JM9UicmjCB9Y >Y)T*a[O ,V.c}꛶mH'Bba£[o|ͩ%IT(%h\%@5mm-\u%.vLIXxҿ ޭ|6ۍP AVGRi%թJ:!]A0\HE4\&&_@Ze6{Ckdm[5.d8%ai9َŖvv~eInSrp:Xk'N^ԕ]ٖp[)JP n1\:}\Ɍ o |ڵkpznKuZRhRVi\[&1U(`D;8,1u5geXSenBNWgY5{p*ؕS8jZVE38 ]Hid]ۊXM-35<&h嶳kA xcJd2-9XJRJV3D_[(UJ;w>z[ns'6.шiݾ A;R(8͸9-dT2$ږ"5-Jњ~TIQʐI=I j;9qֽP!*&s &Iڬ\۶JC0'=khx@mJIJBI#ApxT iZR 3JEvRJNqiy5Gp$$\?oHnSI i.N hAf1amғVW*Eԯ:LH֨*W_.Y%JdGTM꧲TFa S'V&>^;jy8r#0)$z=1Sfaq=^&Q銛38,ۈ("ʶ&eM}@hod[kh k2A]l|_ڶƭm{iEO[:{Q-(ξƭm{iEO[:{Q-(βrx㈔F{WZǼk)=[؍:yDhObj,'v{TTI0tZЧOT(eX#OPlFDy=1p7Op ^ KLQ9WHEyǔ<@MsMۀhVʆ YVAF&g%b%we 4_l8R+<]iAmj 3z : EjPoǢ7<(y& G:׊5tC@R^}p oCM6tܭ>%wVGEVA#m\n$l z9tMb#!jme>E-'0ȭheIe@j/D96'eU{nw64>ҝHuhM ޝ% n V/qo0BJWlLk=te~!IJwߺaj-'7xhisMҋ)r7sDQUwKΕ8sip)) UKBX&fEf6ʉ\I'I jo,)׶ rܱGW>ۨU3*N<ZQJ] DV)Չeg,|.ċhE7U}H^;g`Bn;ĜVhtfj@i+o+dY]=P(}R(:-0AN]kn@VȄ(ñ<#8O\}KJԐsJNP5$X f$QԻUR5n)_RmduPu Rz'rY,-t5A;Qd䭁c/NBRq[<Є@-(NܬGA$ psצ'eoiBY4;n6URgW4y˥ۭRVH*$9N:\$(g@3GuĪ .SyORo@N VuYB`BwsOIukG,.6JU$ٖnT8d$[h{𪜮VKsɔJԔ! ûHfe L8ȳECCcƭ\* ?Z.xHT%{u8ҍLul44HO!}bO\)մ J$ݽhÅx;wy~u-d$c*gh_zY.YYÂHĂ)6;KHygO_=ҔvlsV38i~8~ˋeLJ6i)*Zl%sJ;*`aG>y} m  p^mgcV1g0&; 1qOcnj[2+*Z*TNsf XOVtW,=lohlhKx/Ͱ-P LޡS8qNb)m2}) )-PU1J"u*;J-؛7k5IiYIuS]ii!˕6MTSeffe{򅆖|-lGʴI23i%+ ($l L&KρKk}#~U{V cVx+uCKeM"&dmMxc///U%L\4BWn>Ph{\w{l]pZes) v`UzVǰr|S QBSJpBI p/XDNZi{{$teYDj8-mp@l~"W&h-MtlAI9q^y92%pWqۍ4È-ݮpNLO0} HtU- mCXM(eJT-A)V*w\=u<@KTJV,Z . l=xZGOXˮ`%$*S2yqڽȴ^ԴFBpoKRARAYITƎ% (EXgPo$8ࣲQl=JZ 92BLuTbϐ.!jNR|&|jJs;!v*!8/ݻϭ@ 9k[m,$_dl|+ض3*n%\ݐz3 7RPu-7a$];G-:o23LK; RRrτ, Ԫo!%M zJPm2ҟpr$ޒv|( ჉6O#p#0D f@5&cJ/d3n탎պRNU\j!v8ˍG]J')JS pWXSn)$7)!cx@>߾R巪v)ar.M5؊=ikKY-5̶s*ɪj;fPWpBgt d~T`zJ`DUҔL:恷1Kh22ѧho؇f] m+پdX2āa(ND$`!EJlHރsǛK.~ټg֐{}Y p$`B1Zq5bɴ-[͡*%)I0s)B FesLXn)jlTe%Edu*7ȴQO,啬*хBR.X D5!+UOp{h~Uv7Rn@1K;0,{i9KvuM "KBd\$vB9u5Z¼|ʾ=#ݯ+sQ'58҃d%(ixUe4r|Ǡl\g!jNR*<!@8-[(6瀜cf,ti$I'MN^갺Jm*ǰ뤍eImP~hZpӿߨZojQĊSqD;o`q`XǢ(婲<Oe\n;=1(!@\pMrL poyXe UV#2PQ:r(] (HT9wyl͛Cۓf@ΐbea;Vj((&Dz^m򠃔i(yZCc0,Eӑ(چ߯Î YJ$!(EDhI=jW05%ЅWFW<dh )Ja|,ڶPqOFqƝ@ji7X*^\= qE3|WP̈́ܣʣoCmZI ˞5_\mZ毑wtR=ăI,Pj* .<[nZ`os5n[x67_z5\jJ y$jxm+MHB$ew.mRwcZPRlce7Sn달;xik{\W rH& 9*28a9ddLBJ}}w*\Ԣ[I$,(AZ0 <)cWab8e*Rn/XB JRb-Xm"\=lXU,:*$ƦrZӒͻ0*B[AY Ca=~i;E~&VҽbURC SSdRuQIr⓳aW:4k RJ5wp嵫i:\Jo0ɔj 5Lz\)Jtn7QI>;q*//3BPIKm[H3 j)6kAڂ߼vJB@ LT%(Y+>.MlT/GLbNu;yRAGQXmsoENۇYG$Uѧ[b7XMzT▢[PHӎq{~ ,(Lp%Fԍn~z:?F6tzӹ^QQqr4eE]*B{I2G)ʹmEǀW};5j4n-@㨋NPʰ'Kꦉ'(ݛbfEVB87]phBm#[) RLG h&7PN3gqz멳ǐ]e(PDB}ƺ$G,OݤiiݛGw*~;K{:LT9I0:-qͺ#H{6ԫX <.N}Q%Nsi 7MМvi:sj]R+x8PPJOYhX^@U;^qj=:ā09 ǿ UTߦΠ8)Rˈ5!7'1aTw68;+%WQX EZ%|u16C$n8K ֧`+9g2²v`X'nm<ҡ)P+O}}W -*Z-X=cgȚ;K69}ϸI/(dAĖT҈)< ;]=10K5i7Z@ԁU 2jQ6Fw$onWoof:ӝ!R2@)&4pL/N,BƓc³iTdr7l_ R`ba>#^oڼ̺36KKÃv|52b`L N1;VJ{踈,)'#̍^UIN@SyHR6>!hDe(mjH19ϴDxچ^$1Hre- eZ&)͝ ȶ]qL7h?BYҤO9'Aqqͣe_82*osKhT@,Zc)~j6;[ﬥ&!$쪝p}БBO'Q[N]:ӹڮ{ٖ\RImκtBieQ}ւʲG8^EY(BKq920axRWMHtw>Y]#J R 'r; h~(ZgPJ}SEBQ""DG:ՙdL1(լ$vIeģI)m9ӺT=c2x]--1A!Hu%i (SJ HQ\8}Ҭ,ݱd]vA+ I+@*P {^IܜF7#ų#&#JG in2I7DeţeVP1qDa[IZ!!:IPh D`N 46$yQl=Swtժ@&)ɰFR}҄Χo\ 0 ʔZv]Ν* 8 FR] Ԣ+R[_ m E1Cf ͰnZJIJZQRzS:E.HLv\;F:V}{KNM'"[gA]ʥwwxr(نJOǓY:Gx(Tţ)`g)M-8NΛ'J#3~AR KЩ:!/l,SW AsUur*M %k )JАER'ȑ]-"e#!rsDH!GSI lKǔ vF (lhCM-NXe1GRu1CJŲ&KҌ)nʺtl}Ex\ k%43얈O4))+tRK剳WPܡ̳he) Fqv(\LLNQO5ktluxʂ5JBҀ*t^))a9ԑ PL?>B@\\~Lj}J(GBIOG+ EoRj/_DHWX&JIZ}X9nCkiH)I֯.lL+N̓`@QkQNV_eZmc;.9FN!0 gkP'T ZlSF΅ۃڨ kurU3j]ZJI;[Q{:04s,l2.j&`)6I54 &MQ"nyÖ2ǭMwcغn>~ l.})"X>ĈQ&;[|V`|ql$JN?r,]2h˵FRJfcfѪ<-ƕ cI(kIi>R@x ʾ̱0m}^\ruT[]H8û7lH*ڬOHv>? WT{Kߤlvp7NpCc%{J>eiO*v+&S:;ċWD =R=?rLoS /na7mpy҃l^1i*Xٞ:Dd;Y+g/ Qݯb CI+3/Iw a(+:'R ami~,']f Ep,GWM!X|1Ø2%&ͱw) 'ΧJR<ќa[s$%e޹.UǥJܫ@bqsƹ@.84@6QʲwOr]K Ы)v@@"u)ŭIJDVsx NHJپj D]99A¡2"RVh'߈=JUÆ]pum9V9Wʮ^ gr,1v¯t훁1g7ION=o,Kp8WVBLԐ:>veMx o>ϔ%E}@i% 38*ʍ. ( ,~N:m2JbIVM%!~P$6tqn1eexuQ5Js4stGq+דsd+aie6{*0 UPW3"y*fos}6B4kRaiYSJ:mD; IO_y.ɻG,|^ ܖi%BJRd-H)#ttmC79:}znn|wj;46~q/FJIBs'b\F|=7*}b\[} m@'*Id*8'Ryr5a5Uΰjn6ȋ(e yu(78XtdDIẬ-[Q(Pi JBbbocqYҢrf+,)(QJTk$op(ڤQ(uDs[m,1G*a] F)1Gw:gGY DZ͵Wikqp˘$ĺ(i9:\D*S\aSκӥW>6PlTxr`ʮ0ÈBTg]iҫ(6*<#R1*id8M͈r=%)+Y3!!C;D\؎1 g-=n]"H%'?fh,)ujl鼨Iھz٫F m]Z:o* oRvbI޾$IJ0\Xߴ, FjHk5M"#+t)k9攋Ԇ8jY i2IB0C,MPJʳ0KmuC~vVŠV6x8J vyT|1Fh4$:꺱<ЅQ7b}\]8C([ϪǔYْ Bw5q0N>.vP2 7Au.T:H׉u~2RK֛$e܅dWh264(AƜٲ v+k~9=HO]&R FSK8iv^ llF[! 84(3K1W7㶻UL-RVY:i>3,%\y7 | IC!_vzueϪvsP:T']e5/xp?&XTMŰ< p=b8R#hFEFi"j1x|ҷ#~iZ4[I ̣ʊ،eMHϠDf8%[p Mr8S6^{^"i͔D򚗶UMaO.aА<{"\$ԕ2S7j@o#2L#US.;Mn1!4q,[ghڛ݈wMciZdl m/N}ZBsasmM8@=|R\hA3-s:JS:pG =!l^hl*hR@h߉z5p^k ?3-6ӷNgUl'+*Z@j.%=Z{ͨvع\WSJ9h{I5Yn3enq6da([*eg:Ątd5O16,C+ۀj*baMIPpe)6F6A% rxZm`EBۈ_]h=ڻmIxQ5q2O;Fd-&BBN)l3$t 7 :wok om$|٘RDeJ|ҥ&UI$my V&* PY@К[`Z\06mդy1Sj҆F=+CdyQ_}_h$$3(!~t!_(^(o Վ!0x5_1*)q OI$8ˉ^К(ao.(% ҢL FjK]0dyu {W* 0LӕԼ&YZmeW FdNL%[JZƀk /Rӥ2ҫ.[c۳@ C-{QGy{-0Z=Yu6ijWԅ\o7+/~7}*35u7t)<;>V`e-$R+j[*Q b(^^ wf%j8xnmyUݕjG[gܫ0/m'F]t]O jM{EZPWX=b ^@3MK:䈪RJJ Qu!JHH:b[2j) x":SC[ǽ\J \W9sgprTX%GkD[1U:36e;ŒR)cKr$x]Ƥ恙M\b򤤎hDJ>ًRR.3\py!/iQxZEY]uq _SVָEǔZE )I$ iWb*bټKz8.D@8peHn6bT;dyHCʵeogfyzРN:r~(!ݶQ9T,.ehyݭ<@1Z6RF@<ļ {b;.ANKgs6ZBњr twObgizP vOuyge͖t{{g @΅JWzWJen|"Sci+%<>LYx5A乪pHWP;pr{N[NGz r"vyOI)r)cED}w%9wU) B;.>uaЋ Č>:uF#hu&E%L LfvBd/4#w Wm EKO| f cЎ_,*YܼLT毫mmzA^ʇ/83$fRGhweQf1 S$\deE@OҼ@aRsmr( lXy! z`(X-Glc6azݳvv\!Տ"&k <ꞷS _g*Ű n.ʴ% HLPY)$QMЮ3b]9ilo-ĸXTI ˆfQFvjh!Iʣ$ƞI,-&ӵ_rOC3-K)vAXVа~zٙj]MIK Ŋ{ 8q) ER@׿v>‡nJBQr5݇.M]2}XPgdFyJBcO)J=̣ߪWKo\ B(M}wl.uzB&enVLeS'X>5.3r:es*:԰D?h2bAN}ͨJA;C+ƱEʋ.(Ϊ.XEQaOvq$LTN8 ͕9aτ]ťEP {EFGӶ҇hBɲ[M͚[HZ)ؚ2B~ASw~㌀>P)n0H dE&'Q7f09JtI$8\]SpĦ&6ؚ%M`' D*l4(@68[)SafZA$^Y\z'2'(H FޕK}62[֢|=&_U*=`< h`r~1[ѵ6cȍiE2QPHؚ@9bQa=BcHLk$`&tL`GQ=eWDQ)[ŜmXcBI[Ҍiݪ QBo\NPG _)$!d}{`&p-nTwr W!C,<E ԣ+g!|,mPOmoh4ƱU1h?e%"FTmxd|ݑD}@! )RRA$P7pq) !!-<* ՙtލR~u$ԒXV)waÆdХIs22' G. R mQZP jbD`9shA#)6'#$(E8D++P@$׀Ƣc)J5?Td(M-tiY;묾T $(卹$ڢҴ-±k-47$r7= ~BWbPvV' y,Nu03eC'4%Ew%!P#A96d<_,(*>w-Iq gq "gDG6)KFV՟n-r5$+ )_z6ֲeiOWϧ*x/Ph~ x ܓnG.}iԤ(&Fc"H'6* Yht%+•FF3j1Gi?Nv |jo[븫ldn&#ơ&ME='qdeڶDņN?F6Arr\\ N'RGHjmYN`DTQAu_Ө*i#B%dm#7O ZCw` J`D&G\zպZHJd"HL&!2{+ly.9JSM7R}8++_Vlc9Xi+&e"dSwm2wwTiOq eD"0AҦ/.۹`%$H2GyڢpDhkdd0@$Ʒi̫D5o†\4C)9 wƝJ̟ JU?/v4TJJXPDPeHQZlM|D:yպiS ^7ԇ.(k2mRWlʏL'-o3B 95^%+)J}>~ux=u--TH£9ɬUs"ZAͤH ,8P:P9Ø;|ɹ錥ZYY{Jp YXxil(E$+O UQKJC4RAXJ5>y+mS.a6vP1*@Cme˃wӔ|\_8ZqEKY*RI5-թT(Iԓ\Ջ}RqRYPQ -Ѯ"ri4h=W*=Oma^<⅍|)N{_ ka2ˏD8+U,(Tu#qZq=U'rڗ>69ۋ ٔ&BuoM2ˋ®9ed6TlsUOڊfg^[b|0ƦSOSvH)$3&d{#eZTEB)$ Fb 6Z#@(iuJr;sy ~p#O5O1}rRHB 8*MXq;{Y *_'UC5 Z}[$n-nb9Jp.;WD~i+C a|5lA"{SVmouq5?otď\4g\KZ@ɫ:_Ap{kŸOa+Rs!9VW@KqꎩbDӡWo qAN4yvKQStLXɸܜ'!qPi+ZV BzҳLHwb9Y%#K(j)gZ̲PEJuzQJ{6p;8*{o-*rdžپpA:59D+hۤt@/|>wDZ!N{SJN7jveO %Du?8쟈.@@Q7MρZ3#Ĕ.Y|]ua%ЅGI#ܡ"#ĭ;gpf>\fJ_ [xwWԤܐzAeSJ^iŻl )J͕pkyܷa1T8ҒBuSu8Ņ'nepPLWɸlCpb[\YtU +瑹]8v6-Ԭ#z,hAL6h*oQcnS_*uvEq^Yj[`r1R^f66^Hbd6l#;UڽI'i^+L87 T ^XXŏlؙzT96^h,䇴eV`KB!#t)F/^qhF߈T ĸ[Oh9ii ? 4ĭ9ָvh鍠dm>dLSUW'2YNd\5#A )Bè{Z|WcRH;JOVMͳw坜nx)L ({@֐6c)ai4%E):0`j{a\JT=t22i/83=F _ZkYx; fnP 3{*MbC$))y)W'Ҥ-%,U`y=g;'pZUƝ?pOD(y"cq/:|<,d6qTRnSjR3Ychrd Zu*;Uӥ\ %q5X)M2 }{5`> ,GdE;SK#,&jco}#4-H{6nfuW |@5I:DyOmr2!% c>7@޾JW$ +S4Ԥi p:#1\듏S$k* [XV+R0K68q֛VG*_ČEܴL`i.95:TBil-j H{ֽ* [vbPTI&T5`&ʮV̙A6HFR`R|LTye2l:>y6n.ItxDe*vSiUI`J/DOkQGT AlG.ENPƚb)uI "8X{"5m\#%L&YCi'-{BTN@lc%e/!Im"G;P_RZjrͲ$iBBT5"1*/DB>^sOպc%EsOzNu6ʼ ג[Z}4Ѕ hC]4$WE'-G@{|z(|z(+o_W}'g*oJ!O+Ii&,PRPZ(^ԛf0{Hvљr.Rl#B6褱%8좫n#ej,PY[%}bTI2I*\3VVw͔ݰۤ$”UZD" mA(Z/8IYq`WoEI'HNU-&ήç<4 2&.>R! :yPaNY I#JJ!%҆Yݧ.@*a >vTiX'm`wNbK *`ey=-U  B}BE]C T8+ MHVBGP^}GBOV`i4@|Vx>"`:"SOH/̾~2u:U'41tdL7 ˴^6~^5f%A=?Ÿp,WlK:iA kSʑA]&V<#l^)R44lY !# Fr@SѦRT.rt%pwREk^tR&yd}ź̷V̨>Bt[RX1LZux'X;yyiSvU!(d<*67~1\ ֵ(W$qH$-7BJVu\k.pޏfnv{-8 HevPI m%#d % y֒@uҞ|YeJx+_`z6&0dx^BUkl:sx ۢn\n,ꢋdy!#ZɟbJw U"$L$X~q/8n9EǩFmҖDyB%jz_)z70uhFiNdFt R} D6Œ)mE怳x~]-!ԓמD:+SMB&fw,AAIBx%-8%aFZp_ʹ d1C][Mv*?W >֤a6 3#U$wDwU{u'#YW8v<\w! Kյ*J RA{ը16Ҵ7aZPV2))TSjtl>n] ;AItm9i+pZ£ ZJ'm8[MlOpgt@⬴QҤlTYI=zT|e-S𲰕!luRL;n;UC85u jˌgF N_(B疜S\|^a ߊJt)qI*$샳y)9ݜ2BM5JaRh UChc%I vҜR2kV$ e:)ݵ::r"_ns6(eC^!J!`ۮ[P%Y*3;Thq^)(qH&ΐS&t#C~ЫaDmY78O)I׌3L٘BRy:,xҞQ+['mKV~%EjRmܔǯ/qAVd҆]ջ,. lƋ"R_7pPԤ)ąh#Ʀ"p7'Mo&m v\q8w☹a4څcEnV݆wlo1\\B ~Tw}*q-4w%Gy:I: 5We$i0㫇k)7jښ̨ sޗ5rZb.dyJ|F&5T9I2ʝRmU@8xj򥰴sn3;0I*sr$h1;}rq)kL ^rXp 9mZ64%%eKQ$΋p(΃ڊs`<{] ^^6ZT)HIei&D@:)FBS))^☃8P*Z6@9 Q-42 Jkꇿ$.2%A+5f>Zc֩ loqj6YDG"e;TlKRmO"\TBiҡnT{D=ƛ)|Ab%*F#lkB^l%.63qÌJ`:ݦ%ÀW݌ tUMˡ@82.?*i.$T@}lJL|M:iQF*Jmc*=tP0B}ƀF8 h4.%*:ʎIM6]HA5ODS`$\Gx@Ȕ-0HN u຃,ͽ B A1"QwoM:UHKNȜ\J*: ZA'2:'Jqyκ6Aܔms 'Ir[ˈҪJ s nc:}ʩM@̀c婥\W,|>fwz鏂^1v!9k_F}}_ח56;\g?Dmܶ^ʈ y{܃3Be;ֲt(]7bH:)'cʅ,p jhrgظ׏pR -cT>',e%.-rJ<'`y2v5tsL(P*ryZ3E&m߅U?eZm^on6{.I4up(,tHB W ~QZRFQs8c+}V#Rj=ʈiTd):ߪNyQ/`ymJ)shUaߌ4AWҗ+@]>\E5WY}M%tqnK}JzK X%D-)@~+U:'{Ҽ% qnđ#ݮag Q1OzAtYmI$5,XǸ`Ȕ<#_}6Tң+x܉M6ḨW[Z5v‚} q!IZs$p[סq])ZtV[Υ=ݓTb>QӞ "Z%ӫB:7(=b4TT~be;=_& ^Ēg glrc-B=hڔBc2ܘ'!'T-F\Z3S>PGH$xDm&bңP}\uu%R>o ܺQV|&+y)k)D ;|X0[7ALqeosK+0.Ug؄xa!#p{KyӾs o ;!8|_V9bp"]eʋRTO2I>+kD(y3εW.1ebhiouGZu#+ ywuNrz4NՇX; WJsd:PXؘ杻'ݝ}ʪўͺJd~q1۫VRTI{W&[A|u,I;@,"$0\R)5&8au$$ږ? J. uAD)IZg>0BCV-gȀ6Pgy> ΕaS\U7r͝Tr+ n e$R3`6ivvF@do^LCS5fVһ%>F %G)q8TH$E4ʐ%[hGSa*a%G}J>D8\y-JB#RܘPڅ⛆ z .N3C3 i߄p693P[sTm*)ŦA*ˢ(iw6{;*K BEžTjah<Ԥ5ֵmQ_J p9fʕ; $q>̘| GĐigOJM [fZ[j qR, #L&8Fi&UE$gbhDeRoDz+ +4ӖҎZ.gxkq/dӂWwSx JgTN|)an8D)$m)"#0˕ t5w!IE.s+SEʖTnX";T3 a^ISc eu7hΌ=Vշ iE\;,TUگ.pDBP!)@dSVWtaXJDw)2ՐBb)mw5UJ묠-Jٙf^]9%Y$A1P)/7S ʒy幩.qZbg=JOJ܏9U \\Q";?R )tO|\qKE;k[ Hky|[wTȃu cJ~Ry"6-.fqkR@6 #?4KJIH"|*ujөHJA9+&j3110TFq0䩗 D#_ʼnL}'6L|uX8*^ڋR3.DsgޔE $ ID 6F8:R}1x=|nRHV:V>T1R]B?/v=C\LT(4Yևy$9X%e`;$F~V:e#DӬSG,RM]Ӗp64کMZz BT\}fI*FX֦O/(bV5S0FJ+&)l4RXE zpň*k0FDz\+b8dO ˱SZFuP@$X'M&q[҂|)D0qy(MɅߒu$07!l(lhZLi-*Lȭi"x}FY~.mr!)$MБ;Umwaj-MWMRPӢ2:*ixY-hw F0Vо*Upl |5rRիs]]{ϽI.!2kj**2o m[>r'q'*_*wM):\Lօ o#C(/D˒`h6ZGPvHT'cj8ڂТ$ w'[$ ).TӍީ>4_PvқDo4 [7 .K N`4c$(^-jZdɩo/1طjsIH$lTTDwIZ˶Vr)܎lCRʂzJ  Lv&6Nu}Tɢ<}@_lw >jb>W}P[PE7XqZF}) =Q5}_WRk S'FRԬS#ڼ$1'/#a2x[Q.2y_W}QCB$.a)܍>ʽk9eWdu#˖~ lz#M}&aW򓴧,8yl4[5cgTHgǺ||>ly$Zu {fVe>z1^1ڼCKmhRAF`δ@ DF郇o?暦+OAKU=J#df?o-z xJgC{#<>nA͛_5'6y~{ޗ8jزlD((1#.Hƾ:z x Wf=֏[r۞ϥO³:D1q{ MV,r>ZW]#u uZ ܒ9Wl8շvީWm9tH%,ԉ Z[uQcwIIX#OԤMƇ~tW}ϓ ͦBm0,5ω=Qu]0*$H(|_>{=GWԶW'8%=Q9$e1)n*L}f5RN#l?Ǫ. endstream endobj 30 0 obj <>stream Adobed                t""   u!1AQ"aq2#BR3s$6Cb %&'()*45789:DEFGHIJSTUVWXYZcdefghijrtuvwxyzw!1A"Qa2qBR#3br$&st %'()*456789:CDEFGHIJSTUVWXYZcdefghijuvwxyz?'iZ#wm"F>9 3=VJ@PCą@ ` .|G=c X__b iGm%x{c cH$D u[sgc _"n;޽/{\Au6 D`w&pF/0:ȷye *"BRV'9 aungc7û1: u\R&$u! >:[@JRB:޷ǘ`-pFOUȽ&: xovYSr.,.q)"yD@[ 0:'gQ8Ou1(#_uM^-Zmb%$zVɅA)kUcG`p&Ǟc/tR[n{ װU'З!M٭oe!DLI@@`nA ܀ >]ҔH%Q$n^D9U(fc.ռ(ArzR!b а۽|p9[Zݎܯ[mǗ|w(Ԥ(7H< 2@';m1&8߶239}k@}o^n6=[s6X1Ë6ܱ +X'@96mM}ڋ0BOҘzVנ)g $glC?(NV"!,<-|rvdAae7F߸og'Fb (l5i6ѷ}nlQD `{opO&p~Q#qPIٛ|zj4,) - ecNnL#[Zray`n`+l*6dD3#2Z ˣɨhpj1R RKZs;s?c5/Єك[PIq% {:u+k,Xlf q *pM PY'"S3EMM3` ̂zij~ e:(qp jb|WP!a"AgPE`|1Ztw*˳:D5C1I@ ys{߈ŋfT%m݈RxI'"sP@PFDZ[SV;HJRe$F/XU9n__'iq,8ЍiX`8^v(,0]AgEAٷosP C$y'3+ԷN#0G=[e8E8,9IXHPO} ds5~оZg e0{u_E!V0<7֒5Tm_$r I@3|*v)M(# x D[WRRO s}/ c{|xH{sj!c`Km54ů :q~#* \7V$I9V*STy;͆ʘNDnꓢ.u\1eL#P{V؝pL*$ rvTXN67kPH;7`b2`Z5U`>f֥b2`FgvsQ'3$ɷMhƛ !R{*.WN 3IǸaaT ԣ2{R6%tؕe1Zpª-a xc ,=@uH3[^M9@NV Vc JʂvV,/maA; ǰ q@fcEJDimE`FQoq 16m`:@; 7'ۓ7Öq" %mN"sIHii$+o8 q$8a#0wӽom ]vcM(I #!@ mce;O;)Q#Ǫ+ 9r08:z1Wt]`؛8,wkq[ ab./ca\qkz*9o(x=չiw̤"\}tjgeH6|K7"X4=NZHc}*J8x 7mnH OۅObT@#9{+~gۏ^( g,{T7#EkspƌJqJ)3wnhxdý8ko+Pʱ{&6ߗqw! 9G.:v7$jۍ |G/M:Nq=Ō {%2F%6?3̸x=մJrTfR7xsl}CkmKX-{<6]_}.,/|(sq#q(BDd43ۢJpi "c0un}3\<~/ !3lnMN$ڤq0I7خ{pmȜzoLn҆%N[ʉQ𞌭hڷ7oN>]nw<p;tkێT^|@w{6ƫBPF,ƂfAn$lbwx͹ly㕤].cx}PQ O~;o HۏeOy?/,xb`XXs6+~!:r6' T cq`6;wdF7 Zֽqߟ :vU/hnkrBr)hr)9Id+eV (qZ* $DxŖԘo thƳ*!Ռhd G0Yq&G14V Vp X_2554i0]JqHaYFt+\}-w / IwyZq(?hq^Zi@+ A'lrQ}C+N2 Q<{jd0NxWNl*^qa@+K- `71uu$cZm,RWR C$!O[u$d=9ڮ3aWY&Veԫ+\`culk %^jXU 572ҒJt_XR@mRY[K+8L3o2$p1NѫO0HNzfǚS;q9Zৄ,&iUP,/fl-éFf0;L So{ǻk{0-͹cАdfgӷ@ĥNby :$Uh@7᰻`dwb,װ0Gw6 ۖHm|x+I4 Q<Zm11 7g0ijA pz-=@G)L!#tGLWfKx3|6V+ ZI`6a;}%x) Oy@S4^eS퉕l SQ&zt6YæaJ+%Do[x|eR._RPJј/Q xqvQI"bڀ"^#m6zR>UX_k[}wOuR wMY"Q=mlkn><,X؁{G#U# ů|\FL}ȩn"ܯ߄$xjp{dJκl8niI$aOeH Jעތ{dThߎt ; rp}w 6nl|^Nൾ.caF f~1n(X 0ҷQp嗻v_a6Ԣvpڷ9z MqqkF䈲s>xj܂Eɵ#{ c`)Klmmϗ$$9:emly.tsk &[4M{v#kqüae1p/ۼaori꘲A6[:1N}[ 1$JI8`HvЇTBǢ{PmpIl8/c, وw= k[6|8Eo6\--Ԅv2}zъ kB^xx5cÏfb Ơ6$pjbB޶HX ~t%vȞWjXQbDm:mn7"O@ќ1]\ c3dHInjĩU-{ Ⱥ^Ga4&Y 2 U6L'-p z˗ ~[iJ!hԊ~P"D-sаnT;N[Zu"U290PCcҳ Q߂f:~*;5qiͣXP.@6kq3d/XayiB.6&mψ]"JET+USOTĊVm' |mԦ֔)21םԚN'T)ɑ8oBNA+qO8X WVXZNYi2@϶ 俫uIk~h+* G',.dxUHХ$ْKN|'1M^43 Pz-؇mBEm=;AW ! %oǎ3SWOS8 NPtb[3ɪ)ֹR0S%MPb O7 gz1r9WRێ!L $Vڀ$ӂlR"ʣ}'yk:ȴLUt$HϪNCrt[[`4|<4F#Iu$`sA kYqC QgܨLJb T+Xa:̪%BևBv +`onn%n }T4o itss8BXl6a02{ zd ( <;]S%E-4Ӊ&2<=Hw6ZFjvԠ696%H-SA11rݝtg'#1\.;ƔԀfaYu@JTrΎMGT#6a0iiKI"((fN@$Z&Kӎ$Y{ĒA؎\HxW0$& "7g-$FtLtU z%x {+)cFWZ瀼ZԠ7-vc9PFj">uǫNҷsYfydR+9hɵBl#FhT0w|sq׏1[ A[Kl 9p"B1dal):0;r km݅ma]@l}ܦ-☷^AJ )Y~9 ~X5atqUۏ( mЬV',<њ@~~I@+ |q\K^mm#֬஦(tvdӷ`lk.3&v;\XG16Fۀ{ k<@"wnt˅9$9mlccn>95 "2ȥd!7c ļarc9k{BU;poHPڗI8ۀ[|Fg=QD-k9waoJ6qW dwGH)JHZϢ+ [٫ԭ}eD=l2A<  ͉$qa':8u>ז„ROp`c*~iӽ߷DbRbRL1q#FrSnȻZV6ilCHO }&$mBqbEmȯ{0[r;}on"fMQ #RV-,;پRqBIJǧ㝷CO(.,$-6){wmP83Y1\pLݴ.E8(ۿ5ު-'Va]Fr7<>cH>"7 1ZRݯ`[P <tJ7p6ǢZc8qGlr{AsP":]J>; o8P<ە{-…*@؀7HT7~Lr}[ٍy¤jpFlV&f-q%IFy`]l4j,E:]Ao~7vPaf*kkngǸc I[$:DF]Pxt[, [{;'``#kmpnOEF*T 0+c/q!I,8\-}qs,qxx$ ';j[AD<|;ޙύǷ%X $k~qfW( O2||>,zQCܽ}M=9EN&$g4IG뷶Ǘ7WT 2ձ֣qqq`{ k{{YlP mo4RJ@m$Dx[e6:IC Co1jOx" Xa(5 7&^a4ㅣP,8Jcc7 zvڔBUy#1mI #p- U#E oىl,^BvOxJFڎMlr-rO LJbd9T&3&j5N3+Wlu!Qt,87ӝFVL5Jc,6rIvǁ#YR4(#Q(M>Y):XU7mP <6Ļx/Γů=XݨkVNy*MScƝ4#Tε _Ջ^㢶%$x96aǢ[I|aH҃X@Z"}v'Nm'\a{zi0^qϒ9#m6)@dFyT䂠"2NvJ}̈́X &9n<{ںޭce;cȫP]V kCZ0ݘdB7<9N.y "qvZBTP"FSdD$:LV;MD$:LV;M$nZO& \CxHVYz5=ɥL %$8h Z:%hZ)J00 * '1l|!IJ!!J ,dpR&m1莅j^k^r߆ @`m}mpdQ'=[ bpᄞy-c~ޱ\y1n>(.P nFѹ}9ͧR]y[t85 RC #"8%INĵ%*JRBW"pIZfSӀ6$nd3[Wb}5I.] RIYAI܃r9 T׵AZ'mqIru1b;wl dbIf$w$}IEQɜG @mIϚlkmRWӽT@RRx< QWXI{,p0؜L8|bAWnzU|,@q{p>$DEnH_QQێK?/~3\ >Մoҵȓ3Ps1EaJ0s8b6akwWj,EME@ EZRU6w[cleuvI$oR fztH}l}d`X[;VPq;t$XXX-wcrO+߈20-%G]Hw테J  Nw`Am͉=Å9kd<;x3JqcU$mᐷV`my)R->#.uh0cǗ}:6` m}}ͺ sr'?Xs충R#0"s[NrUoo0#Ug~ ϖ;v~wŽǀ: &[ <w p;qǖs6N`q1IF4˧Ky1mk$p&~|q+M b7" MNjp{-ck(7y<$\5!i) >CJX́]$%Z{q}ǶmBYٯυ2tCp{ 2G>"Ruepm)p<`zCyͶȌ)gEhl8.SCSq'g v$~yaSXth%$ل4pk{|uv-ݼ.ٽ `?)b Cos]ԥWܭ:#D)hDX=֔U4J aJc1:ڶa-)I$†.rl-TU1p- y2T+d)ա*cU.'Noͷt&_4zjZn˂kCMMPu1mZWTMiލ՚C45nICnKs[I^"p>ʉ&cR_j_UPeMRHNV>UP-I!&<$n[hP^u7KT5B1IG--Z( kz~ޱx&\S]K F;D/kbKJIbB6>ɒF&QP)qCqd|H3iUKRYdhd5 Bq/+02catmKKByTK(~ؽœr ^.p*PVU)$fTZ,ut!,7rӠ(DAHcSԴpyny18` #s'~L,~[cb1!h;W LNipbgMŰRxO: 7Rn8?1ovc_QǧBZ2N? ݂'AB3 1GN*S`&RoJ:Z[xР5>"ln#4!^\,a8dueBmp+4müq_I򪮦D$n|01b}ňR`sGiDڞDǩi]0ar՜*lLn0pukc9$0ށU庩vp1H˪٥(RB B;IPqo1TYm^xn }B9IyǏf$I挰*b8|9Z۩ Ď>6UTFdIWb8vjJ@S-IHcu-b7Źp=#–Cr9v܎dl ҢPr;q N.#KCf\Y<9JI 0x~' ^v$8k_Ck\NJ6LJ"%^C NRRBJr&f¹ޙ5)h:!$ƨVx”I IZTF vՖ\[28GHPO^soq¢(2<>a`/tؓ|##+un8~non wo|춶; ۿmܫ(Y+a*)g'p9imB[i(B)J+&LR'S[x,k%|jbtD;>$99o8l9~{rX 6['s:ie!vI_p6-1n<nM 04)afՅ-C=Bt 9V=3jC-+&pa>DUR!-|I$m8#ep^YL.uDl/շS3Dmf,vM8᎔$JXݮu' #՗N2IפndD"=K#|{)je$LXFkh%Hѡlv$~\pֵs; sa^7lxKHLjbJtMgxݥ*m*Wt=])Ăa;żǧG:4pp;kM;k{~ǡYde[b`ۑm1BF 6793#]q2H"AZvv[myc q1/dpXXqam=EՏRP4ƣ=񘓮]"’H=sߴ ^jp8FDT'(fǶhUXxm͗IkpӎAһ~6Sюëü@@Jnt*.Nd*tDhѶ{A䏡t]Qpǂk IЎN`ɳE/M,j 7yP<0}]i8BQP#.h㵷ߎ/Bgto:UQ ;Xb̏KEVţ5FfꦈS('~{b=~]m5{wy qy*H',Zzy muT_W)i ^.8%i'}Y1j̹|LL  h'[qK#AKN_HXkr>4UDՕ tRيHܪw\^Å.JqSe9lEET8۩8']T pBBAE\ZSX)eH"Z1k}3lk͋N*y)$(zo1]ygRbA$[s96켪/Ur94*RR<1>@k{)U6>ݒ76>i;>kO(3E5LuJ# Q,IM7#6O/E1&J:NBN6!w-t)㠊4*RNR*|KVziSo6mx,yS(J S`6fښ;aEʋTÜ':vRxcXnV\|xb+ݍ~oAYuup$:/Qt=K'{,TPRLDB.VA;s^FiOչA-.T6#[%IX([bȝ2޶Z UE#G 5 ]pxjRrW) ^N IX#Sh m=.P<1 -s'u}W٤WLV_%q E*sHFE!vDaK}C:I [o oZJ+pUL{$<Y ?. #po8stl`Sj#}TTV[J'IN]ٽ7/^ kԕ J $vu>Qup@#utCkcSWQ䆡WE;bVQ%Vccp6~Ҍ8`+jd|ΐ,I`ZEcj|ֈT"ts3l*I(?jຯ h۝'7aojꘀ77Ǟt#QEPPETL`enaskUÆ9/i]ͬ R=r\ Cq9;EJ&J&u_4&756Ֆږ <;L< E* W [ջ4F6"C]UlQVu[gh$p2!1^b 'a}~.-Ư&{\LjwqBuK؇62PӍ(\-hO-!Z}趷Cް &5eف+*dnۀ8fBd?z$" : v]v"Xm9_Y .E^M+w:F{&`WP"Iidh9&|xZat[Ch!,20@ swXя*<(0[m}@}O +1"Nvn'ۍ]N%ZHZKm ,!Xq 3 nU8i6d~ QN@rGt Hl6_%*YVg ʹ;{0t31: RD"ڃ$ $jJm!Iw[ny1{4{?qoH[ČjjĔ`hHq@fd’V@dV[y-aֻsm&J:IL6W$H6e $HBd%M7[t:Z/A;~doÇvz̗`7pm~D5.Gv<;VXУ9O&{JHDm "[$e$ڶVIIRWI2A2DZ[Fou 'kmߕ#R[̓o:_K+R@ cklxp#{せVjO^4rmDJ[(VsfEXDL:1Pcå #|bTc]v\>8>92$@}o/b FX̓};rńb4ĞG l'Nn) %+0abU0-N)gd=ǓȺVf_{EnĆĒ/p}Y5H{ ru\lVkcm}=:%K)$ÐPRQ023ǿn@ #4M=(u 7!+>z- s bđk kn PM ەp ړnk^$-6OvлX6N8!*ÏᅢK;JP.;GFtpܭRrrE4n wJUӛP|(/M/fYit6R*t+Oqf➻P40ce)m[-`ɨowxg,vq"HGqKr1As4Q 2覤I<.ȹ9B]4Ur9K͖Y8H*!'n66غW› MLA۳dvyŜISCKHA vn\t3 JrHJc = :\jT9`&Igk7h! ";yҧVfGTѾ<0_fhՕjI(a}( cݫ\߸ǁ W^߿|q2ޗkT$)j.yr JuWǓZ;ӈ#uj,Iȥ'=9|Qd.גyi@q6㑐FeGj{M2ʖTTIidՌ2kHE)0I^=0Of|9fWTUNc[ EA%9qU™vcc;3u`;ZQAE;vW8u7MbM)g@qH2ۚz/6)PI:j8[ɴ aF+ خ)Zi%Fh]DafVRC8N>̨E ]KRQ(Q`ʚ&-}[@Bͥt_wCo 0NsMmQ6 6E[*87Hr:Y5=N ˆ-‘-jAr,$'i(]󜚕Q;䔁 A]TZ S -̛XY)Ҵ3xn1X/|xm;{21^$mp]kiЫ;Qs66◈R Y6Zlge95%:Dg}q;@>!d [{0[ȩmIBi`HI;-򦏃)H5Jy/Ӭ9DՃ1ha!XΦI50a< hMMhi!0$ $6Sfp@ E +E;OG4$"S4=Yi Ey#c9<`-x r4L@‰ mU '$0|:5 /~aIlLF[3l7~y``u2dPzl>y8uS~.ePCw#b.nٗU5kT?jdFNݐSI_7n>&1Sgu?uf5kj%EQbfm|yc<]TL6\E#X:lyIV{]1 d&3 $[x`bTY0LO\ uiI%H#i, 7 CY-˲狀k-*ʐɕb R*1`;aQQHm^W_=8tMP&͔6C0ί1EIY!NkȆ(ۂ}Ej'դ[v\\n~B BFQۭ%aH% I '0FG K"q)$ӥ'.X42` ܁mַ@"#`P X ka."䵖ll.whJ$ױ+p>#߇kn7R_jp:ȂBG;iy(9r$ @ʩ PIHJbڒJ  ;#8`qG:4lT}#cN7ZT@cI$[X[cspGLZJ " e:xYDNMX&xa`F[`q1F 91dť6)VرhZ'd2 5oΫߟ>p %P`BH+lYʳᕹ9D ^q5 \ݔ >?n811m*@Fqu[p7I +{l|6pݎRH)IF 6@xh)(QP3=E;ѕb7 [qƯ& @nm xchC5F;í$rLtYr׷Pፊdjtm{Ǐ]-rU.`l&,")on-${#ӷ 8Ak^V8-mnM}U>ot%6j(X:(#ל #),'JL)ˠٛܳ? M} KqXLώ {I+IM4M`jrI!D{&(iL\mku 1we᪲xU+=>*=V>Ys LH*9 Qs)*<גus!q#-4ѩvhem’ڃKs tGTe SQ8HIsCq%!~fJYbf;?$&cюR4JUx]ecE}6hh+3Jj5h{I fk6̕ڎ^X`W&, ҤXZa0nWo&d `C0 ܒO lU=}b*+]qN @IPÌͺNP[ Nv~ɺ7{ ̔re2T$#XsҰXC%@$I`vt_IKcﰗH*䧅!T2 YQ`cu7 *6+J5A4]ר\*; Wb0ώ05hwgxm~E:NxN(_ZUVBV= 'vY͹E*l5`^8xCgP!n4zv頣]DjKCa@NY5Q#l m*6\=Kw]m$cy.HN8 6[d=ںz;)hKl@I R+)޷]S8ߏ˭Uػ|IqݪrgS$ruQYe]߫^. dUvH|i ȸթVŭK#[[_ES_LDZv)166{ǿQS_BSNy#q r>ZhfB@%;>G¢VCiĕ  #9iHZ*\ZTBF_ES׾  )re.$LX.#C:QWfN(jX+!rQ_XN+ TOF\Je%J5:y5\+_5G<ڪ9azJT{EXX6qߊ=[Je)H<=v#kgZʊ^_(KGXB )&ǯ](HÜ* Fc +p`89'=g:53ʽ~xs80[1htbgfa?Ln66.E9r\ҝ*rʤ^5׶M;D/?"ܕI&Ef$-& aN %sbjHX*:byI&樬]@IH*XQ)ЉC%Pu9 JOi׭ښL׏I'ebn;~>vV!Vc׳mrOGp>>#`mJUͭ7E'pQ*N<{dˤ.ssi $6lNg p :Hֶޱo^!yD殧 X1$ w~|U.B8өJKmw०RT q;ؓrL#4p֖H߼r- \l.C oN#NJW1ukL-JxGmWrQ!⣟n=YhfNzYg34=RT-D22:,vDd:UP<Ɗ**>BVB@$0l. Jyt:a<`<c]Lϒ3Ku+̒pHOf_fi [T3;L[h ]Io9qGM sGRlTmhu-A췇hm$mH+sԉBvs~;|{:BzfY5Sč`]"*$#;ܪOEvU(yJe9nFne~HSmT9 Z # 1:鶛ivSUPԡl%HpIdNc\hof/jzT2eHRȌI *۾Bjǘ㏵X2B0O ]kNŔb/a4sՐ:%}Xbt̫5Ng ^Z^ҝ6ҦF*xi؇exӬWfu ±@.@س~e0(jzih)+TIGJ̪3>)H[7xEC͌mAEE:DʆdddiM.*(.r6E"8r):F[L70Ӎ+ $C):#} KOyle+iY$- K* pA׶.?s‘Lc}]LJbAY2U/Z1$~C n/R#{ԚZdyGGY}Y55z+!OsHN 5lEPV˖WS1MYpxF,+r}>͟/pZ2*E:*Uع/r.)gSϦszQiBLõJyT%.8R' ) >ԵIaFc_{n_mYuмyR$Ej.8zq2)OT%X/@|g fz "Q2+y, Ջ=mm]THۂݻNg":X_ . m|(c Nj8#pV O8Fʁ0כ+\qbW[iÂAH:e:.iʐ1tGh> $6$c;Xxcgn~>xyOR̄_MiCMxV"svQM L FtD|~a^$(;[Ⱥ$)F R$Aͼa"l7X{T{ԹT\s㏥(p$.Sd pG {1L930m-оNsjmNgԀ#Sӈc]fƜY'MNWB@EtC7V K*(زr)0XDŜ6[, %F}z˳sKa;RW{Pb[UWUKx+&Qz~D3URxpMEM.(Fc6S[_(*2ȎI]6=t̲ m ʌ,m0C[X{7 _PsZ*Z8qB~1Pg˷E6ӉHPHPÉHNqM0q)#z hkἮ=M,KPˇ?,RVSeң̌ՓÖ*X9\9Z(!ueGb̂Im,lrެG%؎#{F6⒴FCZ.@ :Xpb(jH 5zr5ţtfmj]۞xFvB}63mI6Mchq,=J@J6['V Rɛps8ǚUhL7폰1O|u>;w(["_kV 8n@HTt~#_F}3N`jdH-Lt(6r1 vq' J,nJyݓ׃B͡oy /j;˽)VcZ(PT@A6 |׼ۉmhBu< h tۓÔk#e`RGk]5ƪ$onҫOC(>wtQȍ"9-pWU})  (Cjս>jitR9V3I*3X :5b0=c [_޻0vqR6t[U6Fb҄ho54))'E߀ǣmQq'qWx s.c:4#f,k#eb_ILj\Ki$!*Zʕ0'2cK uUCFraI.Q]h`aԐUw\BFN]rRвm_>?QQ$Ψ:ąƀk*-;" pWϊ Ah(ڠ/"{%`4)hB#`w'yv6!hm.>Tby.ԥ`4({j? 9fx[Vb$N#K3khQҴO"Js9V}l%;,HkrW-HS[; S r ]d^9Cg4r ؋pxӎ;B,1ǿՎNL[DٌJ:s:+;!k2>X_ 6ENlt3HXmHC~=FȽ- doJ7i(%ׅq$dȋJF)R~ x MIV$r+RSP J As}`ij*BHp%ΫrwX}}~tչ%\4%}_q-:E*m UŸ$[twy=>e2̋-DHab K.Hչ'MFњMF4LR.emlypI(W%*n q&gn.F쒟mkn %5%iQAJ9A}Yauu2p4 O,'ZձuJӥ H9$z7k!))%%-qP2 ٰiC}\<1ʊ:b̒)9) jЂum^Ҿe7eV !)"3P6,1_w,"Uʚg̏`sA6]C*FXUBGIV{c{z>[`-U4RE-Buo2@2M;YQr|סrez?FePōmbpJ}'r|sut37$ {=\qk,:T6n{\qT -ͪÌ*NB33S=T! fb۱q'5mʕwš-qPXcn$ihհ{z SЕF t1iy/nbvTzN6U]:"A'yU]:"A'ySDAՙ'-0nPz5fI s';$‘T¡;@z1t0E ٌSֈm`r]6cř8R3R@ FL̪/\Q}c9kl,n'~(Eot($ü|=N{-eh=ZV1Ka'cuҽCXU!|5@0lReU$JɅ$Ya'Eη޳>e*N!鴆EQ{S m#S@#0(t̥ɰNZJ˯[yR#r% -c)MzRTD{^j^}ŕN/i8@̤OKKbm?'}G&UX dޕjݓr;:y 37!l_}7tqcpA3=%XASA"7|+XD =2Hkem[BrzjJt1H)J98hd)Uy fC3Jr&{ ,tہ yCI =>m!n( $HI:<|2Lm b )z?LNj*@ffU$if ߵoĮ^UAD )w-@R@b1{{\ųPv`Er"z2ԋ*7VI'};$HA!plue+ee+e%K+8H(B&OduNV3(48I*+-Ku)L<8N" T#!nQ<;OH hCsaD͹ }l'hie5h IC(Mj?MhF,Y([T#3;S=<$0Ie.DFXt/4bowT[,`i:h8mU*f]#MQUB=b:7-/kirǥ٬D~ָ.9Eu?+7I:-exl N$r͔.)1Ĝp9nWARqjJf UL22 >8AU- V}^-spى u1{̞8ST҆IPafԷ; AXhV8*b!u:E~&xD!mEcNTG(BFRH-Vo>6߻UW\(ɫsZrAe`C+-Ք  NߍQPyjtGL. #ƤSʘg'Zr.e˫b|X$Z0%% :l8ZSS{Q*r&rJox.({TkYQ68 9L@ݤl12҇kT" !g Q $lVTN%d*(fGc;y }{}xzv,0mZ/ULeb N_Jt7YHfjddQebNlq]g<吻<z2CXJ4L21/!D8iPȑKg,-:SqT-KGP]e+RS!5 I%ÈcRxtZ6jn̸]Z”UDtU%j.%]g<)cGtwxzRlp ZnWWR.Ϩ婂UBf0v=6 l ҄_mߓo夒(]cg4T\ .;#KX YW|uQdmeNg+"*9d3C ऍNS -`û  dm%R#[Zz 67 J6Е{q*n8q15k&=v߰#HĝV /q[T $vNn@U;'~!?_`4y#+@C-!So!vSQdz6%eg&H$ؖ s㇩jZc8'wjV7I*Gh_4Kj.ER@ Zg"uӇerh+[B@4SlWHnSkH{+ s:$J kki+_1;ȳOЌ7%)#VD'L.Ɨ{>v02t'2]IQI5B8 ֌n4đlwK\ZKH*0ʁ'D$pў\flyru&‰c<)'9=9g3jUݴ+ yo2SmNCk*a5M|6p/f9Ȟ>\4es*r{b3Sa@lIZhrV5J! *#-Dĩl4@ū3UCG4v$iC2,_P!n1MAUMPD`]V^Ep$Ӹ/gͨ1dZ3:uGVpTau*E7'Y:ʹjV2SLG (^1U冊qMWN i~AGy8ⲑ%/1AG +W ͜WEک!__N-_5q8n Va/QE3XH#i^ÉҪM"1^ - bEcL09bI MçR*y*YW͌EO J4f+{y56ehRUSyaGMUy-JN00CIŻBW] j`,̒*3-Xt@ r\1Ǥ[d^zI v3q/ݏp 7D:ERlmJvK^`)ΜƷo~v = =e$,)6ԑ}ʖ^p/J`ÝDI-f>l,pnw>cckk /y/ԭŢu6 z\uC{+nVRnJvӔZRg*Z, PCk}40'*p27ki)iA)g=`%~SeL^f]}Go1[9hAo'Gu| 8ܨ߂FQ_2*`?3R[PbwKlbMl +4!T'[jvF]L 4KmNAd-lgUmvJJ\SJp96PQ ⧓y&`+ID'xPh.ƕ"J(̱BvfJfC 8Vc6ǝEK}ROܪq4LףԈK,oKR$f!6q\AAFEG! 3Nt[KC.J ,Ap oA,`^'M}{6d.UH敫i!#,!G  xcO&ʴƶ`2B4RR C+TgGtH֊䛥@yF|AQJ O<0=9 OQ g>A5W zjP^@{av܀E/au=B 7x m۫VXqVoqBNC܎*ؐ- &luCrQ'TqiP$S3E?ONq˦$ r XӦԧ).D$&0*[&wg4&3L(JQ$-IP @c܃%L򶧚Iʈ1MUSK!rQEpS"&FR@&mLK\K&̬˧m'hmm;vSHQ` ŷ*Q܂H8X [Z1S(CxB@$ԈlJ9SHX\J-9$<,͡l%a)椧A0fQ'`9:n:4xXQ-.m|?j *5n6##7iG@FܰnO1."sn>}DiosRa2%--.@H ߞk.RWo< :X)й'UW;xYo<.@iT)7ËeX%DCm/`*I۴,A$gG42CI}{c12s:dSr-$E\^!&@xmWV-^qm4tf:髽S 4S/QBNP# (1'8A Yr n6cc }^۳yNӝfнȖA +p7x1IJ=eef<[ˏuLj; IUR)Eb!DCm ]6qv^ʶ$XX8" JU@S~7Qł9}n뾛x%YߜA'M5V0nf!-Jí$Ztܕ׻Tm qR9ZMB.˵ H${lǚ,T} ;}e5Sc]C^˵iQs;~|M=N*4֫S;ًK?NQјzrHR+sa.hiklmmm7mFimKB9-#32[ ܳ{Wh*jbM8ZmmN; 5 LKuo 9U0OH೉;  \^b-!1م͈ '\icĒw$ሱi#ȑlF{i.+SHJA߃qWIJݺPS )JiX8AJpI ZPaV#QŷS)R1LʼnYeuj-O[sGt5Se WNHC$gtp R'^ˢ/nUg'ˣ[id[ZAwR ѳyZ5ոҺܝV' G4Bc V[k J 6=q] !$j*Hw} Tt%NS*NZZWr^T*^U%[u M06"pD3-,A,HniFx|lx1ȅ+*lApA ŧJntUY\ MY}.#U` wo8 b-d9aIY-I :n,ĬUcvq~خnU= H\M$$uhW;%`Y0eW6Kevd6r4T8Ql!20 zG-a)¤#!; i,!N7J钧!k$;٤%À?Q+yy%(H^2N>$k;$u~$甙{+O(M(dGI]RWѩk0 Xp%fK$W]hT2ȸ&óyu%F],&dujQc\0)%lts]uRD4GLyG1$O;;07RT'<9#-٬X8R{0߸5 2$JAT3S%Di`)܅k4oMOQX,t!|Xʔ^YZĈ:y]ٙf pdܭ:QnQKY8k,!' BBVI0g@.,4)!Nd, <($AP *FwqaM%"! .dį\utT@C:1t1VKMC/tC̫!]V1 *=E:Ed ],,Rchd@S PȪBC?yʪʨ׭#ZHm eB&xL܄t9NjQ?D~WIE"n' .zu#PetSBbekPeѥWSGMtr@t1(-9%*V8N!9yҥ"tV4A OˊmsAR +nzHIac0JODېQ5i VH2щ7Gj3b(dF3fQ:Fo,0G#]`İ'L:'*XƘHzydu-k*w!]efa.U"/Z+$$I<&Jʘ ]S] 4԰i&V_%;)Ȓ:E(Ch I$^SJˋ`:LʒSh=pR*yL KRd A1DUmWZyVH<5=Bi!Wϩ $4NYJAR@ 1 V8Y<KC/uEPMG]` -/q#Xh&I[\i$,R)wXkYމfJzE4ڂ;k@BHT5!y˂x3>=e*J)%+W9`}WNk⚖lIw*qHZJFh-Uf@ Ҥfq9Xia[[kqoo=l*J<,6 xBMMSDr.ݮF˵:/5N5wkDɴ=Um2,Dg/kҡ<A2urt6+9bK"_H_ǎiEtdb!Y-4P>xRoy5H^x]D&"ֽ*b 2+X٦\XU-~tzV{R~LĖFK7na6T]YT&4HRGs"Oƭ};M82yˉ@1X֞|k^nF9KqҩOISdz㤹|/5$iQ)Yԏîx5Xϩ nTQY =SaBBTiQRBUS$HnTE=Uu\I)kS ŅKYƠepJ9hMSp6Ǥk_qGIs"I%J^>.`2v-_Gsʊ' uWK"SƥZ2oռ)R^|wb%T'2]i]y>u64QXCi 2D @f ?f܌yJ九 b[e!( O=)yj '3˘jlpvsVnZ+iiUf( *nkSYĴꚪwR@+gvf1Ѥp UI,<]_f8Fi@dPdQFqK5tS ™. NiwT)}_~IO5]=wmU0A]B_Ƨ[-7)3n/w=0jiJCR멜^}*֟e˘Pړ[fuC!ȫcUX53ѿYygYw 9ϖ̹x8efRIUP\mz>n19=^YS͚H@hs`*c<9@.ŗ2tFf RB# B5iX\q ٥S2(BD&2nbV!;gbCe)ڼ ^З@'.#uls4ˏW*wFfi aٳH)CbLơkiv,$s!F֍mr;>7IY2*"ӭ3۰Zg($lbx4TBL0n6u ɉTr !.=';nU2\ь+?m;l}uK+>"`NzX2ډeXU&M><"ü'FNyh߆AA4u2lM yă[O%_%2ֈАAӢ)KoC})QqZA0A3=,֪*pکhHAH:<-+H,9aTFlUrT$ $K@[;Pzy)e >{+4TIM]ԨA< ]r>>{N &-FP!D| wKtrRC-2 s 342gN6%t.}ª@oh%MQA/ Ն|)IQ* es׊®e("d*6Qٵ;8J0 !SSR`0SҢMdRwwy,ؐzζ= _VkwVGGOs@bJeŕBHBItq$$>K 7FV&[n55O6-7%*T$: S_RYTIzz鹍>+B*AL!EIW"VA%Dt6xwHiV60h2Į "c!d-<nl9cU-]L;E3$d4n*m<"))R8c]E#@]YE.Ř$g)f5a$N\uȨ5ZHs$ф  $?Fr>UC\ƬȔѺT6Suk4,diMdN)F BB PXwbRsGN%dڟqmReJJ$c2 $1L~i$図o?>,Ck~RS9EKKՀeiQOxn:W3'hK{ rl]lX\1ct5*s ^(YCkb!f@DUF=}:F*\nq'1X©JAs#HŖ.2V*Bj tB&P{[ªܰ(Y)e.JMdXPOfLj?ճ[{o6gjihO9QATUʍ“ID8̛u4QJ)}Yb3njiD‰ >ghS>f"<=@cڲq02+{xف ,> 6] ryXؑ{r‚_g _i[Hʸ5QQ9aIׅSynMF8Aa^ <ĥ2 jOW]V Ȅ{ l֝|g g'J klZc6Mͯk^/bErP86>}h8QiB[a#*͹- –@DZRֲJTI'b\"}ՑlE,‹C\5cۇa`㏊ ܐ}6nʊҶ#aϻ\_k?|KdrEƙ1#xUc4܄dZFSl'':g-q3g<Ŏ~? 8PeYT΅ߙ`/=tv &E *1*<7u ȸIjNmػ ݞkU[ fND ߗ^R`(G&bdo ]-q2t;͝S]6 GZ! /8Jj* uS I]v#NՙOOX3<7nt 墶ZB7䵕rpFj%&%2|]I߫-o,S==Ȳ-DupTp:qm e@~8'9bFiwkǒmX0=}v~) 0#L]`0c1g,q!^83搚Z XҶWͳ 7+k(4M$etn"vA+2-\Y.Y,YüS4i ]TrC59Tjte,ߴo[.lԵRE@e%:Fvmv]P)9͑bWejkp2[@yy4]jo[뺆:0qN:yJ:2Ws~B6cǗqÞ:/Ҋ0Zv3f "Hkcr ~aDLC7samErJr ʚu'Qm ہcj҅=4 2$:|6lަo]qҤe`Ze1:W =i˔\ʁjK磌 T8$as(׭Y\Sur+ uxߖ8HN}}tQ!EC.-`JR-L6rs,mOڎam10T{eH*\B;,W]o3,)J t,Z@U5k.42Bhl9SQGpVJJ'28 @'@g][Yr^uRoDsL}l3mnVn1MH +uE!FIJW8rb5plT$RTKyH@Ϧ̳S5 dK~=ci`k/}xz#GLي,q1Y$[, (a/l >mUJ,/ %d 4!ݙ#Ȥj3i%~fG"4iSQ}{ n ssگ+u55 ,,l,T3Q_|:." ! OUUU5JHS: U;Im{O-.^HZ# Шc!k>3YAUQzT)U o>nRD1ni2JBԽy($d/9M ya5[j:5 4 #Ipe{Mr,* I*jHdJdcn&׹qp Pe]DƳ0q@~ mq8v)9L`2HvH:{*@Qzĥ-Pq:͸UDTKKU@N3K V*nm\à%D"NyۦϑV` [͞ msIJOػ}O U5VU;ծKO)Q:ZjH83'h39[7Psr JS5GLIS3Ԛo$^2IY<.a.XV(^A u3wrP=-|zݾ\%;)u(nzu݇ҷO#rϋ6:lJb>%3͖AU5ACL9^K Q먩j*|l{5J>BmA'[iKKr-$6!DV+@8Gm9Sᷱ=CH?.(DH1*dXii`;iPHWRsu<ŏَN[`[pNI8N>Sח 0{~>9{Gᰰ[nPɌ:Vދ4c/Em<x3Vו@{b|>߻ž?=궱6N{mJ -ȼ ;=7AAX";Oes??V;I1r=Gv{goǖ=Zp}'aO[6# 3.U Ÿ4-RCU"Cm$0TE 'hte:;GID^fg#MB8NH)iD(B4I&i#,i*9ΒfҴȫtYw[83ibh+cO4Ȍ9]4JGٓ*PXX ܹJt),MIՇ] BہbQsSDӯAS̨RdjsUwѭ gdFZA00#0A-u.*_Yy<ĩ9`A{Ye!ZTjR7eSDkI*ߦ7Ď25Q Jz0A7mYEX)u@]8tVZ8/'X5ULmU)ү%?d4}lt+I<>BjYϤ3dB I]3#FY EuvS)QN]l)i_&\}K$H2trgsOL/g4O+TQʆ1 HvCif@rtioHJsʾ(I z̨e]ݛkܭ@yZjI mDLX^4`A63'PŮ1+Lj) FT갻lxayS1Gu:u6H*)Fq߰GS 9PT$f|6zm /tR]ćR QL׍]X<֔4q'~Q>9%+yŌjfNA֤saZf @CQ!nN#ӏ*chlOpF=ؒ):*v},CmIqÍmkRg=vF3D;=d[ZW%ZA4Sĥ!PTejjLq=6xYPFFW| Jc02-ة w#k.7 pM;qAxs߷vzc֢U tc]$vHF(Onn|S:H]l!7ؐO>G~nn $ct8S0gM4jjz H]Bn\Je28g QHAӁq]$dokjvU@@$wah%],;f<Ǐ1a޴Yb+bmoOw7I1=Zmb_^^-bMaTZJ 7 ݕE۳*/6jWRT 4rT*5'-wgdoyIM*O#%%)`L@9FS6x(`L^xI#@u7_,UiCRo|#W^k#:u8%jm|w#yFV|0ʗ]MrMWI5/"G`nBA&W{vY6Y WI "ȠÆǴ=c:f$:bM7l3f]U4Hbu2crēM"JEYU$B^ڀ:ă߀5@St"XKzhUcnМYd@ihtv H_̌MrvA%䐿=Nbvێoa[hc>[lm>=Ĩ'Ǯz^[㏯9 p |[qkqxGB߶2i1gvmJx[Ci6 6ݕb>q|N<ypc2:xlAh|(:c㽽|⫿'EOq?q>!2S}n*չ#-]:oAM!l}U;:м-o0p_ ImVDw#ۑ '{;oɩZm$ӏtS{=hXa}b zLx&6o|o'D&OMz~]yr6ND)iL"ok4Jq%!JJץ P-| 8- n.yT)6\SQUMAM< NPnz+B9ƦW #;ӊZViTA: c23cnqyTTAirNK"a&Hmp΅we8˨-,hP #duV\ jm#˥6XQWCL|sm9%eH)B+Pa unm6NprZD܊6@KčuE O{:t}$dccfjd-(btamqq~~:K/I(GϸPnfu ෹Cٌf}`B;S[.R'0bQ3)^1a[[VPH'c\$Y2˦iэ-D$$b$(qssk*EktI ǘrVn*iSNcihZZr=e7Tڣf [$ʠPo5À7x|E<iUH0A@2TթHy(&e"NYv_U(5,%D$xk[vz4k`qi*qp Eh!03Ǻlq9<nh([X冉T"su6tj zyBͫp++C#1m$[FoATi6Aw!1 S3n45in輚MSN.-iRV T)I[}6.{u–RJiBw7| ۻܝPJ@@B9I7pYc$NI{M0H[.aCMQ.dKLVGFFfI.Y bp.i?[SM,-Lz #u{NMHҨ-rM8tȲX+25L+r(U$2Hm ;J:IGTz3Pąfgz:ą2 & ;^7 n:%FyT Qސ@!jf^:`P4FN%pAa"10'h(RI)PQmV6a=])*X֢VR΋I-tF\/Y=.dG$c؍f뤪BRRpI@O ڍihԗs%DH0vlo'4: I:h-8'%pe'H,[ӉCES5I_o8\g4;J;խURó7G᪭Y)ሆPN]X֦k:.b5Hȅ;idɹmp2jh*KCxfB:F[8^D'9'=Mtn7۩fdqc}٫奼H:PI0bFxGO] *)8C4Ryv=c ~URZލ#A 1U˪+1-oQSU>6-,Q^HfWR} 6(剓Yz32!PX-i OF߷xP1ƛ ΊjJHwd gv34̹s!%$1'}B[5/BRP)SDA=[[%kH&O_LQl>{15,[@e+,Gݾ/YuL 8f*t lk.7~ս.gK 7Xz@<q . fVm6 @%Hv#i\x2H! et3lT_SOL)QV@sF 5*IDO:sFV'wlSڞ5HR?6Gbvo{V.kBdRv Ol90â#H}c1!n۠EeճTߏ1o* kvxX|9x~乙uoMF7R/kc*nCB[O-J! $Ỏ&=jPՒҸI}ݲx ۟ W6⭢7ʻ;=ۺ6q8u=c{S-́m10Zt#4lwR *=l72H&WKlbgރnK*Cm&DOsR/rQ< L,MT-tKڋ(Qt$z䨙$*qcāv> =~3jC_ t4{:,:i²N<`I *vҿ*/L$jbQ.癠E.D=췹d4$xӭ:;ePn|h NqhA:jYQKI߉8h򷗤yUCκ MиnmkZf$$aJ X[HTX%^݊(nuik4a8dŖ|h&ѩZM@M/fR7lTW*$PFc$cc)hÐ{߾z!Xrjh !oE2X?6:Ͽa6o}|0CUJ"5 dnEJ`=J(I"c$he2q:vڿglE0qҭZex_558!$8@3g~ W]zjv^|@:3e{O!2%$ cP#)"{CT!-QTp I# L5t*Hjxh}Ivŏ)W/7Y]$0I6;WngYCtnEK+u6*R&"[SZS4682:Ayh u-Ȏ;q`m*A%LEJT‚G ږj8* $v*#*:FBx7Nj]5N$ÔpV+i}x7`qAu3NH7o${<&Lƒ3mMH`/"![zTBx.ncB5_Q ؓIU .剽!wmUΌ2`t:0N3BbU$)= D|ZKR40, XY.ԯVuP; cv0QYD, CUKRSc'N3rVY muotᎥƣS `_nx=@pO HЍaUɣ}p{ɂD:,aMT4qTمwITN0> Bef,O[ԧẺ89[Z'`` j$qka CY)_Sudv<}LjyTG#(YW *G/݈qPIԱڒPKilwG-ێ(q4s)r#Nt.kx5,83 #9԰tc0@"e3\_- )PNfnׁ`%)ƻHvH0;lZݦXf#3cFBbVʊ]:t(7}Zx(2ʩA`Ϊ[M\%$p z;]%$nl{$oVCCx9Uʺ :#(H qD:ZJT7 yC a8{9 :OPbmG INYZɶ=S48^j =;Tiivu2m(+Hi(2ݾnC ?XfWTuJU*YI'{ W}qTd2n V թ|[툷CrʉSN ln]Ka{ajJTA4˳xZu:|!-+JLN&ܪ(Q ۣiV C[&Fb z`lo"5{ vhљ7 X;Ϛr0R8KJE݊z yq\w _'6t_FsyM@,l ʼn&6^jXNZNMn( BqQn{h0YNmvK^,Lo efZAX I35$}SzOSh,l>g4(R PF;h/dK#  cxaeA cH]Z.c!X)F+Fw;R Z<16]ՍK*OFG);=K0 ׶.sP94Lΐw-ڹΗ`[VgZ؀ׅ>F(c(؀Q+X Ƞ ~-,ɰdBl ܃6{1I􎋫GJ5k]`ׂpR13*=~iӔE\N' ۍ,Q]f„ufIM9"9 Q**ѝ! 05=b jbI#o=tIªxwaݑ~FjL:xLѩ3Pꃞ{3fÛ?IPUT+A (d&Gc,ߣNJĨZ+]zAV8ЫEkY7ֶ+u6>}qQN^яЀ-I(@UyFUf$6i_l/IA Kͩñ-sm#tq>㊪ s8=ŢԼ򐠧FMw*693QBR7,~S)chuE[8r dfu6B 8OT M_7~Z KN>G(ana#b@=7?'JjVZB`I U m[; y!*&m ]X;s[i1lD@nU.>3UK{mm1#( f<p-v8V"iKi q1og*|xXU_,B;ǍjiF@?=Giǥ٢'#e,pS>gOoQ$ޓl #P"o8pTm3mSm ra"6̈́ k&{lrQmLJytX}ӜGI*}_ c[j2K$mtv6ohT qy:,nmaT#wJ1/&SmZjWz p GXm6N 9Uar9qr;}xਤwql?U$Xd'ݡҡ*ŌJN~tXSSO4Sqhb>>tX=G[z&wd8x-> UBO)^vz6P2o5^Kb/?dO{n܏6[_G+#K 7bNSbW?كa{ }v}~ZpYI6k*"*u5Ff{eY1\IXUz?9U6мiz-òuJ9 G fwm-{(,%?XyB~N/0vQSI1DtڲjV 9:`}}kӡ NÿoJ--GecU6U2+36V> OQņ'{ ;Y[:YWaA߼rxXtrJ_}47}|:~Q_}qV7A> endobj 27 0 obj <> endobj 51 0 obj <> endobj 52 0 obj <>stream H|TyPgfw\jө1Q9UĬQq+0";`Jeb6A}.B(Öe^G]VW~߯1S ;znXRL\M49ykSù4Zr޽{Gyj~ӇsKLJKLjղ+W:;p9/[lֺF&eTjyJLJTNqqYL)Wɕ&)T2B-W„`BW#ejeX<>L+K4F~?d% JP@p%D.PgD$&' iH^ Å `"s°= 4c0lVXc߅ؘĢS S?b!H<#ޑJGHf_[ssR3:\e3$k4Z_D2 Fgx=k|'m|CFOZ$5x 89u[ N?rHy'ɒ$h'/@tћ W,с% "5s}{$UsBt>fKcJ5W>Y:ǑAyqx*@m̸ozzUOD x=+h>;q_:tUn+~OlK&6ڠ-dVc߃bH^5AfyCA1)˹`nG-MJvzDMHDhjUkS7e껉(oC0@pь%HUϿ== yK$eiYT7[`#"gԸ䁚*e38[ےP8zAB}5'ne{!kFnZVO@#J˯:rQ$d߲5u_{j+Q^Vʼ_/2Rvy!)-AlxZD[^q'^9InP!v8LPZXdE'rHߚA0`-vW`tP3{!)TE9ۥ]7+>v$祾;SYW|d{ uE(S fө@tPw(PA΋K{4'݉k=T;o7B&>9z-#l=덗+X0i1Lf\lo.3tZ桌C,qϿ^Rh`!}z?np0JB7$F8]IQ%!b:?vs=tg\39 *nax70ωl#lA?q<5x1\xvz7 0=%85/Shj7'4- ɜ $[si A$|?T,W+_Ƶ5H Ubj亡P.CVzT(_r$޸3z9lg {(V*Y5$(MnB4d5¼RIkUy/UN@矺>~NBTH%S0?ރ `d qއ~h~=ܶAj _3C(|W-ȷc v.mQ0ȱjj, r sYjDW +>FOMi4q\Xv:";.uhÈI:C[۱k"3u:eVs6 %RS ,졇^? TsXT4MJ(}PR6Ѝ5$w}: @ꪹ{OI @95i|ǗR-NⰎk0Ԇ)6ȼs}Q2Y-NgrJhѬ4q B5} uqd[ 9t_.onlzaT ?e@tnڊ |%(6$=7SUrT˞ 1G_oCmG<#S;X9:aTybG)BO@B&y 'Z!YjQ[T'`G(:o# *% 'P 5Q 턩Юmk/`DT`߈=|w2 wNۈ0zF ̰P\X誛8Rȣ]o%VxH!DFfǿ7E4UP 58De~+NC@5P+ҋcq4; "U mTj .M,M-hެh{^kYq㟻"Z0`v}ۦYG?ڶmt#؋!Cn ikVT`Yޖ޾LeN`iHo! O$N2y<CoKkѣ endstream endobj 21 0 obj <>stream HW[o~p>J^x{lMs (㢠5͈"}DZA}ݥdiЗpb˹|3"vohś=<,I~*7ZBBȌ/]=AUe)RWnwB':BJYQމ'Sו ݽ\XV$VkUKaDN?7(UZ8CHAdF"O, !}_޽׷$7bsRXceן,~*Y"-SLww4"h.ůy#D&>f`?*YHPa?]#Ws/nMɉ"a'~lP)*YiE[QqT/J{t򔧡Tl9V&U\0}vU/?:ꃻJP54&Ae]AuQH@dCk:0cC=^QQ@lk&,0a& Ի 49JG^ñkD=՞+}d8o - ngi!,5Jaw%hgPΰ;busj,n 'OO3#-Zdp{fva"^eD^g(ѣF;΢a_܎=`ٜf s_+F}. mtM38t[O*)'F4]UӉB4;ٝ[̓ʰ[%T&`|⨑|83rL+dnםa*/?ȓu(OLlq82ة=pOF)!0N D/0‡b.bOȀOBI*EE7*0#8 wx1Q`t<\?\?6iSpZ+?p<_$ɢ?Z|\)9~t6p7Jg7mݤ0 [+~vJdyUW?cp=}r >!pO"@+~eZg5+^j9"ihRr!!~$Tg4y:};zpxGP#,Ý&f2M#N|yꉸ#n ,M/M2tȾXl@lZIQf~x1~|WT ZAs.~GeH"/3YXS~zC̬(ei^) EeY6@Ios|JY/p8L  TʖH[*dKJ$K'IR$rOsC1Giғ 1hcKDXZH(sʴ4MKJܯa a%ddq}РϩUR2D6FM8((İ=T0 ѽ Dc ɼBV,ï,U(ELwމK=_FeNL6QiMp% ;eS\1%SYKUFx.02gcd QU!"(O=[*hIU>Dr"7KaȢFdbE$2C%IVHU)5(r>ƒȐ( } ēf\iVU2%^SրKL}+Uϋ*$Q/E [ЅưX(tO- `Oxhc0(>8 %Or#DZeo2|$ > endobj 23 0 obj <>>>/Subtype/Form>>stream 0 0 0 1 K 6 w 10 M 0 j 0 J []0 d /GS0 gs q 1 0 0 1 566.9295 54.8673 cm 0 0 m -538.583 0 l S Q endstream endobj 24 0 obj <>stream Adobed                >""  w!1AQa"q2B#3R$Tbcr %&'()*456789:CDEFGHIJSUVWXYZdefghijstuvwxyzw!1AQa"q2#BRb$34DS %&'()*56789:CEFGHIJTUVWXYZcdefghijrstuvwxyz? !JmBmW` W!DVE!p.y(!Iq#X^^#4!Dd)R"۱P!š/eЄ!'nleB"e@@G﮲%B#B>[.!{(! ;!G5J!B2#TB[.dJB lBY!E sG.B"[U(]TJ!-9h.BuS*Ą!EYˬ$#C!@BR2WBd9QB"PP!&ZB8 ʽ!E%J (!ECd6/%!\vTJ!'"[*! к7 $\+.P" #W!T WBley(BLPZlm(!D!S)WBtFsD!˲ B$iBe^2(BHyQB GuDP!ڒ*5p^!B[ #d["P.‣[EJ%!(B] ]%!ElQBlF"QB`PeD!.!HD3B@*"PP!ܗYrP!]d{rAc!EA`dDBYpBb%BeG!BLr˗! ѼB.Y]eQ6\[trz!R-/ ^BA`5F[%!BK*#Xp"!D!umv]eB,ģe\;v^J!ur@!B-sAdk.%BcQu(BK.rQBvM. .1#4!I]KČЄ!$6[#vPB$ȍd6DBar ((Bʻ*6Q(BPeGJ!*/%x! ˪>].ȕ"]˭%BdQȔ!B-elB$ʏvTJByWe+P!(RMeDBҿhNH﮶+4mBW#vTJ$!DJ %4xJ!ڡ=;2!Dˢ쇊="WB\Z4%x! ,vTT9WBO%eG4J4!I.y(B@"R˭/q/dBK/% R˲JBE-]{y(Bd ^BN.ʔeD!B%]*B$s]Ĕ-3BUR]^BK'b]e "e+Yy(BLuDBr.J "{.ʉB$PP^BK.5!%B%-tD!B,LdJ!'dJYuJ!Z.WTX\ڄ!6y(!BlpH,'% .UBv(v\[^!uJ-! +.$rPi%BRt@!B `l<ABtc kQS,M0Mɉ۫XU 1|omGucYr  nl.-#ʦʹ.d&VaԶe"ʔ=ZAWnvMjsIߦq4'BvX^$r@ܦ7a k5+:r4,77U[0V^W<}.i&Y1n0%<ˆ:L[?]\?D*gI3ӏXA(ǗPӌr; VTs^!sAåW}3ԑOƋHy*4$Ѭ`J  6BE+(Bd6Py+(Bnֲ1%P!-\Z8ʉF!Dʻ*5B$.W"W!BJF1s3Ic=kaV;Ҕ !)Nhn/M[)N͖Mv ޓ{ \BM 4^$Lq,HBrʍ VT\6DȻ G!D4!Irl6 z! w@BeF]NJ!uv"WBlkp\%!D~DQ~IU@,ͬ.9!BF&<]Ӑ*lB6RWrV Ǹ1hNꥈ),חW&-YpP;:H#pPԛ+˦4\DUٜnqsC{֞=U]8"OM Q6Fwlu[#Z l i5:#.vm*ɩXDZ߶܆ Hޝ[kWAsXpgI%AOFZHrH7&F{H{{])SNfyѣEO-d6pW6 ϖ^aMͽF:_5GR.)5NkIggLջ~Fp\csR^,JNJ =olأX[D.5d'䔸ꎑ,*OomRy68f;}Soi 9}WA1h-ZK qTMf53:oBJe)Ѿ4wT~$_8vFΦݟNii)ZlvP mQΒp.z9)Qo*S֛{Ǟz $I81O2y%Z? ]s>ťrݪw8vIQ!dZU"JpƋ7z@_c$9RedգVdaP=WVBٻSv8sq׌X99EWk!P> |~WإkR;u'-Jlt {.lϖ6!Lv;sh * ' WG(vJ[@25 5,0BB%.5%yB7TJ"YlD!B%[ڥ,3^B-qe@Jcb2UꖾS!95Ll-8nBk0g㚈kI0zKdpZ@Q8sptSQpW팂s ѠiU$ e0el/|y(K.=eN%3!_t]dpVTeͨB2)G\ABQ;Cw#3t!ʸ6ˮ!E#"W!B-Y,W !AdFʉ^!BkS,qW R+^G`ˍUB7H fkSLҥF}ہ {t`lii5TR1E'P-)[-`e>&째%(kq-gL 6[=x{u$H& F#L: X-%;RZ YZIjq uoג1_H O.` M tX+Z!(޷c五){ju)T`sOX%;:!M,9AqVo/E6ri"N *ږթ\CtivRNqۭk[L2>V7p3A5!X0w+3wyngU)3ӀyzjksmC˱ծ̧BS-sP{JŶUKXFw&Jɶ*6j2I"@tQ્:N u@]I+)H/gi~]pCEͥ)ҳI&-6hݟoyhmXs M2Y8ZϚrEHwsCOG ^HWni*4%YF'ǷPFy&4|v)6f!'J/gq$d+v֧ tB%U!I C̏nl7g B_7Z`HB2ʍ[hG\ڄ!'TUBʅ4!KBCmtG 2!I]l!IeAJP[U쬄BL PDZ[ 6xj(,jrZE' qK3s##Gq>5L٠fPA;Ln̎sLo^\epPֱ)AcbH7-wDfrW^gorOHIUzZ5TxGTܮp23;[vqO0N%wHQUjN֌S ӗJ-$Mcsw ^έKM*V72Qv@,mM@SM$O8jJ{CYy 4R kejFZ8#cE۠А7)1%-+Zѹ;iQCz؎VF۽É;vKO@js 6^Zt쩵Gyӿ4elW.߇n$;pϪbq9>@ VUq { k5$o<%bWSw8F -sZ[b$=df9]Ձ gIksא:X܂Op.:Z 9˾IVKZNZO5;V* PI&y=}lQqkf28zF=D֊8Nf,De @$)|BL&9׹4 ^ɝTD #c4ԳJZ\ߊPZS%t9B?%{%ɠ;{2N'6sr ޢY.ikq;s6i]mĀta Jg6|^ڝ4`G kγKQ`7yJ2Tjx0nccmvlps01y!!nhto{Zwq5ⵏbt]UvкkwS>쓲vshb ND:OqsKCs7_@ޠ>G^KxxXcoֽYqkBF6nRmuZ<ޫH16=FI3hWJ6Nn"3#r?h z8Hh/솮=!+)1}n{5{\ow: j,`ZjIrJR:;=£$ViR k<Ӧc֒ 6"u:SϴZ .ۚ/ ɠҮC /r$wN2- ޖ4ekE6҆a[Aؒ ve)YIYilfh\[[,./ZqDa^XB@mZ`gUvNuLԖ5Ć0:)" 3}: hl cH͛}CT\7ͺNB7q}NfkDүK4⛜$p33HvG0 pFe;aM㺈 w1+pKKKuj Q d ;7d=bI2 TD{֛ j;T>0.a6SgMǓO"Clhܵ7q=K5Nc𕢞cFJ,/] -:j7ܣ[HKA軺j["torԼTQ;:rܲڨ~ڒGQY3ԮϽ'C09 `z\ڛp[C-K]uciY#XPN:?ӻ_:5ed%hnMQPt%]ݯ +ۊxEs{娑pMXN4nG/"[خͪ_vf`%yds)L&3)CmD vyTm]IwDK/XZFeFq N(^P5%JB*IvcMuqBFmb|'3 ʫDm@I  ?i[MҢI⥛+ T-{mU\/gS+r^xd$g$,jK LlާkXI3lm6='c"H9pK۵pV\Rf IQګ% SdknW6j|*IOH6h1q{:Pc)0q ` rPxj?!NFVqN^ ԇlPӺ̶{lYGePO>${ʥMSQ1;vZ*mnisQa23+zunnyu8'@9l5hpq'@ 2K!rixT|BӍ$v[n'wNs[]Nyk"%vwܓ٧^MA3%xkiSox%+0}}/]NȀ7EtVUXӘ'$P*X"A|dx0 a nb%3}% #cM 9n$Kt~'+ݑp`KۄhVX& w+е)`8{R{!Uo^= @2D]FdI9ָZ ɘ}O9HLP<4HK`V.饆JP lZ,I l*S;%y026lI7n -uIδpR/{-qO^d#4E0'o?a9}%+Z`8$AjտJX^ƞ6}L9akr7KcOh4sK'G#]kA%AR54ϖG m]X2h2ublL,jHWF wipV^uKȕL@u;Uj.h''X䑰2HQ:Ʃ=dG+q6#LN1UU֚"tQו$jt&J Gd6kmV;#w)ܝz^ԩ\ TRKZ3MZ緤l+vARmѐh9NI+*f-۶YL8fF{@{؛YFc^l yuq\hNG+=6ֵ1FTڷU:D iPh.Sҽ5ђ4X$뱦 BX;%R, 撆RTǺ:'ҹsmYQp K0ZaReR2:!!Vc)Ha8-u+"sZMƒ+;VݥD!{x˲H-)B@һ.]dJ!BjG(JCM Bml/U2ULia6kZIyQ3SݏP5OwNztm6$ ! Gĥ}F#׻Ak{ gS@:]d)t£ 4o}-uZaeGOuO0w-詊N۵3s^IՖѧ]\KGY&`i rKM9&Sx{lq F兼܁N^$[04ˀKLp]yr-׹;8˝' ޘԹv8ǚ<3姪Tmh1QOCޛ dGTz z#N;>PU iw:(>كԛXj5ىR5qn9# ڽ3,oK?M/j"3!$h}X{Sh>꣣"@2OYH,k j~FdFG\AL۾"7bq;AģRm6;xh|0[{Eðh3khMM'A$~PF`qXVv֯`2\zUׯܩF)RsrÒaUsqFD><#51,ed!Qmu)16kg qO=!:ﮝPQ3$cmq{J S9nu%Z "3ۼy^h`F6H 4 .4RWGS~$'Q-O[UzIpnHi o+Ni hfܥӞ~нm9(* ת7%SfG{ه J}"}'p2Z&_36i&sDO@iq; +@ng٠[|ME@t \ŭ%aswQN}dʐڎ tL~8qǼ6#(* bsF۞%jzܐ:UF$wI;:ok.:dsPuAP (w=$%=BM1Y,+Ǯnf<p"{otCPO-vn s3,ll.twr{kOۻ /=j+cZk*'"Fde֣LU]twtlqq 2C.\V*fh MhuDG4`{T se4jxQ1Za|4]WܘU.S< ɴڔ-K ;VlkNWn Fu0Ndp^{fYp22Q6',nKP",Hݶ$B &2Fr[[ _jU Xwco;[ߐ% g"3`oXqâ; ~kaig2l,7'|ESFl87IQ.cm@Uij ':&3I)|$XjM'Q=ef]\yd۫{KU#>#PuUco;c"r'A]anm{vA twgbIp׌4s2 ͹cg$367hnZGOJ&(C;di$99&א`sS݇S%4Fm$2Te%B318T~;ZI @><2 }0XAդ5z6܍=9qU]35!-jŭ'.*i<ѻFܽ=9L]\{4ƒQn@ZZp gHKUN^d1Qcfgf$&2ͬn'~꘹f86!gIVW2&Mr^ͪ*,=ceqJVvaDیک;fp';zٕEJ3N%oI*7S_Y;BtpDCb<mnr<:ou3 vB) ZJyW}=EEڵM[ 3CuUZ>3m dǾ.f[/niݖ{T98žut=M>4mW舜NmY{}|`5M8'Ղ&E- D2w;TUMClzZþ>+:|%!Q1FAWbR7]*ށԨGKT,@Z;ٕ -4f uj"GH}d$eѾfs@w=i0$f׊axp L$6.S;Hs(ڦ w:I]U|9zߋ2x}4äsuŇtGK`۝ hth9ÚI1nܥ[Mrqϙ^>P'OXڸV.$8#%׷1Z u+7H܆:܆Lz-IlVIIs 6 RBf ƼۄDg}_b^C2=BdsǷ^4UFgF04%['WE$ۆ͵t%[t@yi-Ku&Z/PꥯȬs2kp2dwKzܴ Q@Sc̝d2䕤h "/UUTܢVyi"X.pR8R{qAq̀4ډS' :kᾚc -жM6Rq̣j4}cM܍}˖ qRq=MINk3;]:\}9!"*l;L"v R֚Y vu)Rԑ"uA- ?C9>:v]c˱1KH߱OEѺ",AMk)LS@8e@{]yuciFdNv/kN!v, |fF"lvZރªHxcudc.) Yo}MRUQU ˾}?sKV3LYLp-/h)5Fp!]  ͽ`cA w{KQ[)SM`NQ3$U6/D:M"@"@lQip]:'Lw4ZځÕlS:Kq$$ײԿ^^t^'̏ VNϱ]<$7(ވj5.Rr9m~G쳧š94Lmm;ki[,L'^#O8c ,IJg a'RI$5tCBj2khu-8hkIr ~#ʒ9" zbZ20~Ҥ݉p4D}>+L&p$RWY ڝ_i0-E:w#$tcph. {ϵx2@/weTsPN~$K ڏ.X&Noo`"lm``A ^Dڭȶ &HMR\/ YS$\n{Zb` $& 2w {,.}u79kRUNu{zwu!Z-c.܍7*JK\ Q:uv_[rCr4}y(fuL*, #ۤd 傩46qcr!$&5ZYͰѥG"&t.:@J5N)>Aak\DR 0A 7B+ "ZRu1 ې7)T7r/#9S/^ezC7=tAٙ)1AVevTNXL3|6ۨ#0-ֽ{'v{UF̧vUcy@xPQ8C 7:'0ys(ouxntrJ4beU!ʉ(k%æ6h;vjp|͜XLikyMXEzKpR7k*Glmvi\@|<Ze 9븩@ñ%9S1DZ) xjQ,@SW:xH:T1I-'0gPԢ0&F]3NPpG5Ur=Xyݹ4oh7< ˛}}12M3 W4p=%-e&2@^) u]ݰ!6w 0EZ38' dD8y^ ad 9߻O ]EHyM\$wӌ$= ЏMJVhsSv$0dHc]S]gV:+-4ol#kQN}"%kbOC?, F[d6ye=8j7oxP lIky*MjwZFl\D~ fUhWk[v-cI`xIi["7ITT{c%:cKۓb%x@ClۥDwFYb\[ [; 5fpkez&VA!":Γ s\7Z}%5!IUA8UsA:XdoduS"TruX4G6<>LwNLa{KDͣViͤ "^H8h ֈB[r| N_(&ۥ L'!q JAN[1(J'ۖ5GJʠȜ or1J @H$[cu5Q/QI7v^0'9zC@Ih֥F[f![.zqTHi@T6H4i=CUm)؊lDzI7b[p;MUIJMmneO)neApXJ}Rj3h9knŚeEDl2H$IVkN/x>\j>Z17Ǚr׫v<*BP[U,Z()inPatQ3LʬW> gŗ;5A\։>q܎s*ղMjb(QG"xd^ՑkRqFIhQ=j6;h)myFSO:8 2+.R2r{R9འ&\ANJ'M^*N  䓾O\bfAD3Zӽ0Q/u1&JJ{osՎDZ%086r`x[h߶.PE0^UN#qG5%o3nѺ@-^JۻA %N콴2%4vm]LÏ> ̽]~樽KrR'*"k9_K$2u.q5ٜ]\CFQj4s4 dͨBJi@L~83OtF-eV:zVT5 ƽg9K]tWk8BGCikA$qKKE*fF GcP@+J(Ë4cmsjLІU:KwRݶz wMBx*eg'g(..MѬɧ *5*c 2>tf@T/U5! &Lrd 9U~jrϞ5+Zdq:XJFVmlQ9mtF\h#9*dٳx}R:ynCϑmVXzGaE0 VaLݟ)7ڐz9j=8R5ѹjo{mdbdߘ&Ը;ŤGg׋ޚȅSs˒! 7ӊk3ZuF2IKskZwGsmNM^Q #TFj6shjIE3<kg>Eܠpf$Dw0Ġ8 (z"Lw6|)4v؏Q)tlu/0IXxZXlӿWPO{Qs^/h|.i^% a !1V͙z>y#YS{" :L}!X]]NdC.n7^!%^5FNݲ+Ug@B=vMGT̞?EāfihU~ؙ9BL/{eղ_kZֶ0΁6w R.iWk}ul6FGt^FL+ebvu"әlrWrFVW- >RՄK 'OL KCmί8ugʊCg}U3r~+͛$|QECs[=M\9)f5-^4&@iCG2䮍B{҂ L@%\;}a8|{ [Krc\K jAژPecSk!2Ce-J 0 5^.$SX"z)|U|%*vQ(ʞa.muƂ,A꩖l!%@9i<\;EgQt;5KZ,n"&'; e6 f#Azؚ#̍NN#D {L1 :-$uvpC]!JiWh9zDnËZ\g>aM읅{=kѤ@5M) è =E{cTZ_3Ç}gUrֻKxa2v^a+T Z|Ɗ? fV.'T1tRܲ;@ڻ) 2n'e\imS*cvkwrLF|Ŏ^;Yi{̨)2-E^PMWlm}v}c$1'zsY.)mntEAS5Gcc M!hو╷AqCSju9f7e%r~F}q68mWSٽMXta1霔D -v {R^٭c+Fn0j>Nԫc;BԟiS˝+LyuY:[e.:&5ssZ2M%IN[v+6csk&߬ukKiR=Gck}콠kRl%:v;Q'jŲjhUҀ]H<DL,$h<ʲ TXxV~He6ETFr]W>u=z÷?Gmw#G cC, <)j\TxkSM#U>ƣAA עވ/?J́T9] vlR*v;^0?eۏW=/(;F=7Wz"[Qj#Nd$ BtM6&h'U l5HMj4*g=p$g[Lt]GZxCɰI214[, #cyäczWk6u2ָA=U^Z3YmVߒ' B1-IbUUҹݗQTI& 3uBrY@PWݏX:Ɯ΀6oRhXk[s;Xi$.mRA2"s %`5}f;B3l nB,1]v{{ AI`әC`%:A c:NlWsaIk`pU0N]ffDF 5ˊwHgQ֝^Io F7r1$L $5=c؞٬U #*)!pTTXwrDq8I#nښڀȭCQjtYb/jL΃lF6#0NRq{.mgF,v1^e;v"QOp+CS|+ )i 9xUJz2حHȌZ[4iZ{, oQ+XWLC"&KCJ϶ 7L(okACH:4RQ0^j \^NfZ[bL.@1-gfѮfBAÉF]Kh۱L9ن" LV=4>MI_ľܐ=7pwN6M8̇i*[L8㑾7;0.=iԙd6Ks$wA#x!1c״ A+x̡Z"ŁSyץ+wXy.k.X^:4/ 7ӽyQ8 T"9\sSǘ&f* 9)-A3V`tH2{YRڡ [;Eo&'%MuP= ġk(ť'-i$A`s6}d薳cӺQ])OovAEͿTGb!suL4k'ft1V^Q5XSV/n|Vz+ 67ex ܠ.䔥m`k(N{`9[5FDf(m# uD\/f`bRibpɳvp|PP!Xmn`2 q:-yol`R=#$ɭlP#N g)rJUڑ|`&``BؤɌݶψ'rh@gC&Ƀcs:Fl#E Wg&} 3zԫN\ p 6GXI>fYSc( *n.*fs}pft[U)*rԼ5znZ[T۫O8QhĎJ(:8΋Yd}gkpq 0`sX8*cPHRK+N$v=|!'Ӝ'XuuMҝ=u;$; !y繅eE<*_gTZ[䃺((n-Y&{sJdȳlۡgmVj>~m3YjY\co -3-V/Mvх鲗 켒ostvh:ǸK3ol;1Ѿkto^SA+4f^YYpU4uNq:eieFNsCgp:&؆=<! ֹDe=]8Hˈ= {*eZO`pt <8gJPuRx}GLҜѢ6{DG')-+X5%ReV)I1 /jWղ*fe[Qhw+,% XMX=%}rj_QNp'Uft#CᅡC33ioil[E\"Xĝ3O֣n^ժ%dŬFBG`{[ cOV׸hY_)GJ/3uUv !|`{{[l p8PJh4>PzfYD1RVc1QQۨڷ\8ឋg 7'[&zn )䩚 ck [3E$mqS%Qsft=1h1^6CJ2[:cvwW-h};AK*{[@9G OLVuF "sh x ݁]ٶD tiIckwM۪uW F䄭=8t.Wh`1:9 %You)q(0@<r+S8``r rZIw(V]`$OX^CO0>tGriIJQa>j%Ey[sz &EZAZF[Lw%6dM7#}cL&fI)&66!IW6Ve[.fv[D=79SLp8uMtw$A+ !u^^0!'=ԲeOfԣj 4̒3#j{2CFx(`%{KbzƷ hAޤHXՀ3]?-5=R, jq@5W67bStw)k=;Swdai4IWju d'{$12=#,[[#JS+04_mNcZe uVjQڛ 1U[$M/E葈) w' jBHIU-#p;<=)"RU62eRX#QWB 6P:QctQŦ,:3kMm6hܑgr}mT Ц{v-kRkj" Hu/Cn!1_Cd2rUA- p4B*\jZvDd{[b󿦜L+.]@c`=$i95sMw\gad\\'@/{D@6 mt坧2(^1h~5U6CzsOGk)4KS BuCiSm:7@ѕ#Q?QBk|M:g8vjHR!Y 3 x­>9X ]oh1iVNm.OjӁZLppGR΍"H{ڻI*8:b NekrFfl_u9MVͷj45NѻN L%ddsAkZYhdEMBۛ"ȭP4)dWTG 8-WVJ.s'U6wrl7)>GkrW:k :O,T6IbðJlgOkTIf#=H8j+G;Dukf 2Ra4RRi<6|)zƈMM&Z = RI 'pEmk]:庼  &Î7Mnd 3aw"QK#y/ot#QPZ0缗9ǙEWi[+mgՈy>Y6̽ 72rI=4h]k֩Q2 NT ZZ{^F1nӦgtq>[qȥ6f@˳)ApI,;S{^Ak24^ \IFeJ6 ܒ}pNi*OƒҬNjѓp' BjhsJՌ2nmbk$$xDpWgldrNmij$)t@"v4{e&W^8)an]nzҹ4gEeh (jo0rQœWǔTIH ^KP :U9!ap]RWse܊q0=HS]5H@%f݈}ÃX6R56{^Oj撒-n0RHIF4%v"7&K2ó9'SѦaL1,N)nmT};e%K7 $sHNX{5e4{Swt/*Pbh*AfT nDՔu.nJ׿pnJJÃ4CXC8H_wiӮh4e7ejnkt"'6;#uKA^\אn2AM3y<(35I;Ѐ0D|@ojaSWn9@Qd;("\;R FDY@0Ac%ujkv;'ByIb*k^A:%$cL*ò*41nQNY,vkZA㼒=Zr~it%E0Rp)-S 4=ki`{ N% }lĒJt{ST @iiM;s@!mE+ .h'k̅{K`/uSRN)'h ^OMiZ.xUl |6ES$c{%)4B!(v U 3sMkb6)yGeE͹PB+bRyP)z701 AQv÷3Fyta 1c3hJӒ7✳kk6JFK*g! C 4[Vy3$X4hMysH9dmYi$9-^D(^Iܰto'QMMŷڌ#ٹCp.akYp6^^#D/`؀\J}y{B (k#hut((WHQځfBBD9y%{DAhV /p5xVk4%'UX"O+[C!F`qTFSswO.vJ`p;.:e#vGq*Np@sz5 \47#my ɽ'O×E7Fou#6 XڼAs\9F9,[Jɍ&56̗GR9! i&\}fcQcm%D\K:^CJEb;>UjT'Gx,mE̹J$4=R`ÌeU{ eT+tz4nJ@zR7vdaXfEQ IWΉ]qW#PnO-EE*{rl}5͕ L<3­FY9pR Uνh$[Ku9&ԇ0![ZA 95v#ubk^oE}_e⫛V׫U-spi3K'=M ..4@Lyzkm{OĂ/y/a KP8 4D0Hb^VPA|8ep{xR5PR;gphPu.ټMd5HVm,t@2YѤ o):.T٬k )Pu:V!Sܴ;Qo3^9hR-]51UńA *=ԎT}qNjI{71A;eS-8j} >AK^fS%F$̛/0P8'@Lw]:! D/b-_ЛnA jdwXaj@Ч2^JMτCNc@SaS^% IWhI"-".a"Nd/q&~I^@Z u%3M!&#^ tNez H6vrN8sjF-0&hY}XHecr4n :."(2 ŀ˟r J/FbN#PSF7BZn / 5x M9Tm<:zJk:\5$X$IXYi#]RuY"S ^KeVZ*.ݨƔ}.n[B3RX9/m#,k_kNϱjOMdM)ZZ]HT{ H#QLV4&/lJ6;N2}v1ۍkZ6`sitZÜԦ3:5[M+]x׃IYUFX n&k{N`=^#I 8}%%k9)"s1)#%_G2Z6\q IywK+292;Ƚi^i9&'{Wglp$OsKfQkj=F=PY=ۮ{Q:$+q z(:06$QWWմAfƳ0㞃n+hJnf9cl+tmYUuH$veNW؛+c۞@h?`ntBJY7SgK=6,e&`;1ӮѱP 5l|krv(s:0 x8# u(MTIQZմrP˜ks%{Q5ک$*R0b9T30FcDt6sp)TĐШX\BOrpħRXYb|Sk#ԥcXxTVG$`^_\2Ԫ\s^qq,ML =tҝ .y(5^uX̣ )h4)/S<8U]*3hlіpA<0w+ M)k/tΒf:vW`+{ i0mB5Y$H !rOfP51Hc15Yc4I4:FK)\ZFRlaF>FCyK KT0kcOb*Zt!fH$,MF,B \&h8[L$;)O>HEBΉ!`jAX8rXŽR֒Xj-4Tk\cݧS|e!ZMB3K D,bWU{An=Va90eҹf+$ij/3C,x ~0'Fvm–%Jv&0- a!2B*қIe6.ع&®X dn&IL^E":xʆZɫ)*e%,[d71&)8}Q-Va( ,RR$ BƐ4#e/ee+#/rrMptoi;oRT7Kf^g%MMy"y?a{a{EUU9C%fBVNҚ6@wXY8j QvVn":K,mph 5NҧCy(7Keg ZG4n!Q&yL\4>@O0=x$4*Y^CՐ&ڨT]BՍi3 Y5˜F }Nn3tmcg]TN>M$9 DֹmJN8KtU蠞PfL2h'-5(폀 gV#p[}Rcsmn-LUr8N@A^b h7uϤ 4\1rꚦS\a7P09=y栮nU+˛Ptޱuwrysc.qN_Ujk,Ve%\sYWֶ8X2 J j.Y{*s]S ph(c{9͢J͔}WEDҸθ)9pkFwNg0iڥȭ+Sʩ  f0Mxn $n 18@XЩc1F>xT}/N[X&7wiRګK+22J؉q9+w||2.Zʹֿ{ r">Y9y%ܲ{y^ày ck]pͽGUL0/R~[Z^r;b"Fm(> /#nNTR4y &%R)*LAB:]Ê$BbRlxD4q>3E8AdJsZh4ZO>B4ET1G@4d j6xXk1Twkj,4vQ%C< m :m8Sf#9d``!m`/+M;!d{ Pt^J Jlw 5 īDQRC _ԓ܃(/p9yIfBP]f}v GAMJؚ4Tndִ,PBcY)~ Ii<{݈&Jg ,U> ABD)9'R-#"JNeCq$!Q̚yyLU3<.obÇWt{P͈!zWB2\:7nn_%{ñsǚfQT& OY3 :<C3.an+=U`pJק:4𱪳ə|!jN Sa %tXwvm@*4{j5f,`Jz_iڧ0dn!kMd}^0dpE6xշH3 4,z%4 б 0[7v.Z4z+޽XFkJX.{r-+xzhuZ^/J! ):KMmnX]v @ FZ ]COI`*5(cc̦-h)VeԞۜ/mY<@M7(T!8tB<:ߚ_5JLE؛exu+JbCcz,9LoA)fnf&Fs)K Z(E"~k`!̎ex%6. $HMnIvNȺWM .v7~WVɹ6f!.%S)[hdVIYc(sxCuqiN\+?e±@I ~jA"q)`-0xћS7w+H{`cYAEN5THZ}J') wqKsJU9$VA9IN-:$(_:ш߱IJɋLe8|e z'XjҰLU!2O%NsY IJuOָ$NfusBE/| 6:>s8jս2E`f<\T^ ^v%/Cj)ہ#s'`m'qc[q\Z`BQ!TJ1ѕn,NH P憘U{fFܔy }^3nS˟ZcI}+O#m4<ӇNa()] #vz v6D0Z@ sZtrnB[ m=n .w:((Y,O,:K+ Rwv~EB}1kTK\%54t "n ejx,0_!~ _גb yhp(k~qAF" .БO 5SRYL,or{o~ i]\w% XDURPthV-腞)_3^) { $a maXkD[jN ؓV=G1n<:(at}=wNs!KFNg KFdJiq(sONP]*Vn,b)l{-$7"Gexgt޼pH$ `mV %i۞"P8f7%;!ò5-W[9ؐ'%7,Ȗ%Rr*(Cq`vjr@b a)8=S; g1&6Xy<6P\ބ! ?t$G0=<S@ZۀslE*SU1Iؔ4w$+/a`kz]WNa :H:Mt;RJKQٮT E,syo"sK#M曱5]{E ; e^[6n(-73ېt-p$a2H 8fVđ5 G+7DF 88ԅqjRwn->85mժZ!! iV&dDI`g%j8:kQlS\ep{ȈJ!bBW w;D>![DjۂQ.׵$ , &%SI6A%P[bkP\(mP.$* &ɐc~da߂J:vngBhjFh'6Uo ԡ#%S1Zٱ oR_9!D8^kpqiXf̹MI\s1GضR<#ئϧi*r8sW4)5B2C!XnmĴtaXK~geuqlxZc%"Ɍ̥cxS} `)Q{R3NR*JB$ڇ^ݐ |wԎҞF737Haؕ|Fi6ʫ: +ۣu&SF2kdqN$]kVmɫ$j:Jb/ZS6}vxr']-ρ< )H+Ja` d Tu<3O(Iv ՗HhrHsSxGb=y Z;ׅv K|sTL..PѠ=944B֍ fX ~V {^!DFz{2=.  pǗIj5ƺ$ӐEYg B (_GpC40c9),D ikZV̲H T5 PIQט^uu6 UCRmH-,VPpGjrɧ"BɃK}(^UdQU<@V/[c0P5Y!`~]hh '_־3,PBwszUOғ캩 n g_sA,aP=0<.]#Sv)OaF3^3XYfL;`w>HV{n!@gL*#m;GjZҜ\k/uPU*63aa`Ntvx{y0- ڠ<U,.j[9#?U-(h͙Ox4?H )8!7 F8O, J6(ӝdKtN;Y9LX<`eNJ0l>uH>ibud%"qPsJ (ZR)fP|;;tFκIi5MY|ӗwk<)kcyNĻ:rжG{J.tQ;ANzp2TGuB Md$I΢UϢNE=Tb2!hkt0:uϨ,exu^Q'.u@ԞhT%Є!A&)m@6M6kWP!5؄{7)blQ& jFNxܕCF!Ii QDy[~ibۛ/BT73HZ,OڧȎ`ಌX ּE&H݋yMƺ:wtRI^ ۊpLJJdZd' 3ّЍ2#$`#te:#! IhB[M:/^f=F*m$$ v_ok"d^vwZ(ᒶHLE7q~j;}OnlbG +&~n 5V G W?`HIQFZ9pPw"tIܭRsS;P# 3Ȭ|P! ()VNN O7 Srک>yY㠱99ebW8Ɓ9ǝp7ax|mx#`Mܳ)/28⭤\e=l#C(BFZp #ӌF/+\s;5Ht7Us[X[oQNomH@Ȭ+3dj}^a=:Yc2Tdtʳ&9qæac\Xٙ.~dcUYc-%d45ӛ:'xʍ HЬ/kڶATh*geZwt_wX&Q o[arЃxwKJdcNsEH ْâ`ݎ㢏tBbS+615j²jVڥw //iܻD,Q=nZϲRdO L;G}9Uo Ffz)twkyAeQJM,ȯ)wabNK*Y:T-)J2RMRɩ2IU p*V白6 t'mhOEpJHghq<l/OJrBJCHFԅdml)3@hJʛbyFAx.20t]3nԂ̡B4M q'Ĝqm\Y-ťzBDV'Rp42G}P! $wkPJ"[DRۥ ^(x! )#LS4mpH9轉^(B=E};;xj8 sjVP 5T:JӞ=S)@k,!biɤυ4^Y^+wԞ)  8jxX8JfbE%W#Z.yz*>;i})8X-ْBh$ "n#Q%VAqB2/Zx&uj=Ğ^f~6Iu V^tU9L8\dr nVw t֦xӛ5v^B*9' }#ƣjXc=s'̺;!d^Hyv$l*Wz=>;KE0xn#̸ L> dŦd"8&4*خiU& i>tu^8-: ܵej3ir=5e; Ñ̴&[A:DT?%Wrvc `G=_C;x0t#5K)+\ioa}]ڍN착HinERo2*JmFG{*tTa4 *Fm`p熇n %%8aSC =*F&;.qMċ'7iS7:J$2HX. y*;%#f|8#kk5Oivt28$ NޞA^!);9Air DlBN!vjxyu o ]r MT&U+BKE~vOdqd 0BeKUŮЅ>3M!0?;ƭ#y9ABikiϜwƈ郹oIsuX]5 H>CoufΦxOYM&=%#I%%Cs2Fn;V\dӱ෷*J?;@..ɮZxBɏu7Úda_msD;kvawCqAOkOf}=C ^ZA}ҙo))Lpq"3d:xTA4qQ>Ԧ<ZA .!x䖣eM+7kln u'{d[o{bR7ppdזk W]FC埧I Zml*)N+ewR ݤhpѽŽ;-:r:r xHtCZcr͎w{t^%j8쉀 p1)ɚ  z#/!rXBy>E^L؛mvZG.ݬx 镚G> T[cnmMn~Ru7S% eLO[ITEN1 -,&Gm{:>ZJ ::zxXX;х#XcH %ua?ٹi)Fzfͬ)hѩ>H!y8#$! W; -,.M^B%p}y!Ϩ9w!B֚ݪKΨfVe:\> ±B`E RnBڠ٥%Mԣ՛4I'T!N \:țހKaQ03>B~H}vIr~^BSS;sX.ir#vr]p4\t"wD!Bt]d-!$!_*%#@eH1]ײ.n!zF),FZݬE(ׂQTX ( xi׼wD*P;iX Sds5*,:4l3Nȧ/a2\ZA}XbOã]ya "ݣP}9(j+ײPvp'ƬXcd{pf-#aPHbRq0Ya͒nVL@4Y [*Չ-'S^JΠigfԑPa{U26m`)QnjJ܌hǕ5^x͂a3Dj;s$'Zb3a[ U B|*BA;ڟHX_u{~[tKnzz]<9Ä}2-2GZOQ Yt1I8!ܼ~V>Y:i4{8r*;8{^ǽH"r@%B :L 픡='q=]F3hN[r|uۯ@>+J9C-x<76rΏubDoý=%փ#OiqXuduZJK^gb-aE$oysƽSJ`#0GUQ4L C:ܓ!@)I;t!uHH$$pJbVr):p ̦ɬG`8]XB{?R7>:2

oRҺAT<اbB ^,r}%6ivPnOthXJ7Fx!NKJ( BJ !_۟3^}c$dI fVP OoVܠQT{&uueq,2 %{hº\wS[54:/㴐U:Kx1Y+ T6㳞`'Ubcݥj*-Q[2 /cOYTBD30pa7e9jeTrTMA\88γo'f> ?ZJu bf)ɫ:L%mWL`(vMH gsK9$!9qJxLX;TCu^2!]r_F Ԟ(HB$(`uTS:xнBnZֵӎ[;fxn/N#âM{ ᧌AB;d۸[Wqg&F]\=‚B-&NnkڴΞ!<}4-k|Í,=f iamgGS?0]#q.JѢE˺&+f]SiVhsߗ-*>ؕvk/twF=UpM/3@G88pXReENmT.ef. ^'VXB]L_ĉN%/n=Y* M51\h9?zB!x4ѪBB!sAZt)571IP3_/^<օ+1?K /g%B;MAu/P!, G(B0F#/P!%:G3qg%(8-bi2,^IAN6II="E,0VEFXZ'Ԏx8 @2#O!`[dyU^A^<DhZD-ˀҴ|zW^j0݄mҕN<ʯΫ>P`e܉JLeFz]ɇڕ>ۨ>y|Tů;]M)WrMh6M!>obBNW ]I{/IB]isq?-kp RNzԧITe=7:pIVڬ,xA~3\wrǭEW q}9;W6I kMã=2t f8 lu}n=G]К{Z7뿾o.o70G-F9n85EMV1cZt<)rZ&Ua $jKsFmU(\`$xեQ*Y걆5:7}QTPz={),9lkupppէ]|#3@޵vk㺤NmsU6ԦC娔m6Ob"=Xb;_C~; PG(^,p4!b@#Ȑ&9<BtgrndHԳ-h=;:Ů( :[";[X9Q;S^7;) \em' (]mXhῑkn@ou |Fv׼RE}'uM1ۅ AYJ)%eumZҡYcI*Ku/8a$ 4o}$G\ n:,,Fz+YuV)G%w'5#CH`-}z+XY YT2H'usJeN"cswK`1uTϒ(]ԱH`r:77^XF["({D!Bmk.7&BvFkB!kX+d/μGCsvsHY G{w) ,Z0tdva'V !J`@x5:"oB!Ezm#v)XGe-(ԛ^UJFC1u#$>HΥUKJ31U7gNަIɭ=aO-Iq edN(ˍ.@VoUMU34BuM5I䗦h\52RCiZ^S- I (TJ琚T~9Iݾ3"?o0,(BeyP:sp떺0Z8vƴʌh>0N$JB1f`t/s#'ə8cu7TpȂ3dFͽU߈n!bBc$ZC:Fo,P_ly tYUC/ߪR)SΕTN9'tpT}ڰܡM;ٍ$T[ *~ W5ҁAdAQ%q^vt(g{^=Uq,^n^UsϢ劆^Oo%)G%8q^t0 @vy>ӹY?^=UYR*椙װj}>1Mz#fpp=0ǐJ}P|/ytF e \݈_l/^fҥ/,u**6vmIԜz.ǚis,H\vQniU(9PZel98)l;tJS+E{wn:qI$;B`zꕹ4 W|}9’$aHG_)ghѪ-/G ֶVuG3AY6xP^<|Pʩfx+?&M.UW3BpP! > endobj 11 0 obj <>stream HW]o}p&!qQڴ5Z,⢐,Z{4JF=I->5lޙὗ{H~I VPоi8;uOEj//<r3?/.G?z~O.oF )}?)c%(r=?.4?^ v j #E][<@:c+O©%_b=zbc4$UI CIF2]~_|`c\/bOZjI1єDY_ֱۖcG?XNp4muBv4H=_ПHh`,e"Dn87:Y#;C zXb`8~(យ1wۤO)ǥg烅(Y*Bfw;_eO%A.#&@Rac2'B ؗ }‹~{ɂE\c;5)X=)YĒ=nSOԌB PY}oo7YV~ͲMf@z!}2w,o0>?*>H[p Do 'j>[8|AsBk-ί7bTC6uAn}sJihcWu=:ޞVBu{捄?ͦhi8ΨlV <18 WqN+5`t:I53@ڎJQt 8[;D)DQZa8%zDoB.W{uVvhkNJK T-pM *bC/aՃ שH?XjV&$ lT{`"hV{>&A%!zܝ9=J#-¡ZRe *:H!Q8H00tPJY|NGb q]n8h&Y@W+y)R10 ͑p*F0"X5)ل3ʺ_&a Ae# Nha8$WL)h>+<@bSôlW&4>.m!P}! 8qsps\p =u:QT`j2Y `ohʙ*}J<%'hmY' !i(ݮճd"aТL\I-xڽ&78ɶ*$pOfpdίX@I˃A(K`:Agf? Xa2@!&I^1] vRI] #Qh Ձ*"Ԙ-s1pE:N+k0'ol>+Ks2sΙFldJ8}>ߝ=I_W'ۓ&rs endstream endobj 12 0 obj <> endobj 18 0 obj <>>>/Subtype/Form>>stream 0 0 0 1 K 6 w 10 M 0 j 0 J []0 d /GS0 gs q 1 0 0 1 566.9287 54.8663 cm 0 0 m -538.582 0 l S Q endstream endobj 19 0 obj <>stream Adobed %"#"&&&&&,,,,,,,,,,,,,,,,,,,,,#"&&&&&,,,,,,,,,,,,,,,,,,,,,#"&&&&&,,,,,,,,,,,,,,,,,,,,, ""  }!1AQaq"2RBr #$%&'()*3456789:CDEFGHIJSTUVWXYZbcdefghijstuvwxyz{!1AQa"q2B3 #CR $%&'()*456789:DEFGHIJSTUVWXYZbcdefghijrstuvwxyz?f!f7##`! A`0 H``S@`@  Fw 02(`s, d! ` `@)X@ /Q n|5u==˗tI!eҴı6xh7tk۞G_Mmx}zۙ|NOGORc1 TO sn^Tf$[WORn\3=tn -61ֳy3ɎlDc:ugsj09;z\63? ko^ޜfrL%d q4Ƿ"Y9]RiiQx&ˌS*$dd@dd@!QI  T @D6O(PN BJ Hi^%@$@fRJ@ @ r]NQ;D$R$d A 'CP*r #H1P!@%(($z!!"v  c@`Ā0`@  @ $<@ 0@ d@  d d@ x $dP HB@ ` 2" 什0x*@ZF($dd`a"66K@@dhLD vH1`@d@`e @2H] 0`0H@ `   X0@0,e@ z#5OqVn¶wZW\r_k VzTݸoӦ\K?/{ږ4R;ǣr+]3J9czif1OIOoꋷ7' 1OT5Nwr㤚fzuTk%Z9=X[k[6&Z)Lmy3SNo<1˯WN?`xMcr.=hoQV J֙O"b1>jE?Wlsm/ؼfLWi11CfgLϗijϪg iqzn N'x""wۖښq>7s^g6tƻ}f}]hKOV]nҬGNkӆ&{~F_iǞЇ ׻/hY8^ht-lc+4k= 9g/OX9䪖ٓRqLf1rѓBTL#qdܝф1f LSMKwzFZLC3&ruydWF;oi^kykWfHMzZ {SP2{龕[:I<7g\ξ߉q|2N{=;zվ h&~+o3厭N'Y۾;} Ĵ6yyGGp.DyF<̽k11}rg_}wxGOj2%=_)6[V>x{pψlo18枕, Z9f$M;{:Y>}o}'r/6k㻇38?{oCJ?'z}ۏ{ ivP97ל{MWU"V=#&Rկ'b< MkZs 3ff{{~ΞoogkLb6oyc46/goG4=:5jӏ՜/h5nk6LDDm =K丽p-hڳc3e]Ly[x.ZVBXܙC XSE g 7O4ap<*˫e՞rBGǛ3*D#3 ]{|##V=R3֐4LП6e!MCTզ|Ϻ V%z-o>08lkD0dķ)Ӵ5kɲZ#8b7H+Z+Dnbrٙse\Ybaz3oSZ:tb"̳yQ5ZگQӧc"tĔ"S{ѓէ@lD(D"#3((9yԵZ#$W|sO%M{i-k9v'O|7"a^.o~~lHv˧7ٹ%j}v{v%=H|'V>&8⸈m8Nb|g1qU⿲7pg,n/ѣǮd#oy\{##so^xnٟ;O_[|7 Jڗvyе13;ki{zt~wxvx|u,mr\ȼT1VNY8Vwj1KW=q?aZQ5bOoqM9v'$f@[Nn+]*s_=3uL]xӾ"ݽ6h3DtnS6ٖ KV3ʝn<{3LSeZ%8-{jZϫ KZ#sFޟZ1fͨZݎҴʶ˫ &tNN̝8 hTYc}X+=f*ysk( ;)W1*EM}Vǭ(^)8em]آdIԝתW7wWM_fwZk-KN4-=]=&SӧS{ƬbQ“lK{g=t4>_FVxP+LVb}s9dDuks+jZWRmC3n@_)9Jۋz̆@ϣMӈS [fj値Vb՘mŭQ<3dMSsGVi`w/:\TW&3K MXGf:.ɻ_ɦ9jL/'SJ˯LC(d Bd( %ȀdR  d$ e Z3hFD H2Td$H$2Hi K"WufyK_.)L>r\~ۻizSNwg o'zȯ[x{v: Cmq!&+Vg3ٓp6ľӦ:z3~u D5bӼubm-j{xכpMoz{G;a[{u/59lDt|/4CM#LkWI<=#?sO41>(>NcoͱgWy./ts ֓6gh^5y'ixO~?{h^#N&6h?KuYo|j~{q|7/5\N/IҘc5Ϟih>ڟ Z4q|}=c|yH˅^;G6)O1Xq=:-Y{:E4Dl=};!l&S2MدL5[{'qOEXVȬzԏ&z֌F>ܼAsiݖe-KNuӳ6ouW:V8iE2Zru纭[z(1X">^"qv>|+֌^#5Yfӿ/EsUO˛\GkOE?/h}^f֌Fӽ-Z>[eblf]ޞ:&'Mۗنe&)R<ϪT2C(\Qܭ( $@eh  Rdy+JD eiQh dB2ZD2C "Ҵ$ F@0@ BP A@ 0 F@1(;(!wt !H  0,+#BD`$pdJ"@%iA@" Pb(I@Pcd0 `Ā `C@<0```#(a @ @]0 H GHvy,;@, PHH@Q.P*0`L]sj|]^%¿'yY W-~&טwokG՞]8iјϔ6 Kه-d} ^ү-"1s.\~kfZr_#^M:O~޿+nMsP!'3ٴ|`s ҧ47xgM:nd}honfUhD{Ѷ#jsDZk Sq;Z^WoV25ulgK=ƫ_!~^ f&:7;Ξby濌/zp1&w)p#ڑYi]7kGV,7o&qwٹso%yR q|5VΝW&ew?RszoY3/3c.>qbr܋Y[-ɌY*wnhOVf%^k(wPi&[ްwnή&Y4_e&fGHnijz/^d]F4v1*CKB#Z{^Y/iQ$F;{NY{fb R{_-JWZ6k5umgK}$%Ydv&UYfY,bo:P/9f%hias_nM ;Gx }|C噳gԚ#[f۷~6DC{RihżKVS,7v똥q;ׯ1-]M;f'DFJRfg }kunT&P7tfc1i6-ݾ%kew[4jt|W׉,yK\v}H2,y,Ȁ,<+@Yd$mrYY,ZV'@!@a !@H+Br dpWj$i:esNײHVֿ|V>rj{թ5g3$2xF_R992Gg_K1bo؝~k=_ S׽IwFgӯ$LR2RmDNX|v\v|՛dinW|IprtiULm[F4)צ+#5iߴOerψ]S1-9u_. j_Sx}H'Ե{r< z:Ͽ/.Kf5^׼iqv:w³\;_lF"Wit΋g1:;/m-_DlzL4.׵jM[׫kO6B%!ԵiGiCs8;R1˩Y[|M=]^[F-^-ki湯/%z2b /89+8G^mWM3 WBQ+W*ͲۤE:uuN~MF\xLDFsz S4ĕ&"/f>Quի ԊsFS-(2ֱVUWzbzЌnt&wyݒ׳V}@C3~tEc F_/{T3,˅yF[Z||ܮ#F"{6[^qU:k{xݼn7SV9fɥhvGhB5DLMv0tI쌼{㺾MK75f}XO%i 2Q@d@Eh%jDCZY, ZEJ K%rp$Y"!) &DRdTdJAiHG"Qj4$dg$! H-R) 02C$  w@` $J $%(d ;$ dAd$@,$HAdZ0%: @ H< eA`@ !: Hx ,d c H$ FB,YE,92)  v!@ BHd! $A$ Yrv H! @ 3` 0aAcy)r @ 0@`FF X00r(x @Rd Pp2 ` 2dN$FFB@ `Zyl]ƛSO_slajr\}z>"+?Ҭ?3q;u {%v\x]H'p\K =KDhKt'sg=5O(=[4=Q麷.|4V^aw&P֘(׎3^.xL|6eFz'_LW׉UYy͊xm;yuXm>[-mL'uܚ>UɫF><9~Y 1EfY)|{r|ni׋j맛cmkܮӽZc0ǜ3^8&9G7q5=܀6:0,¼Y`7&07]\ Ι?yi۵>?^L6x&;Whqz>!Ԝ^?ޏ]ͣ:stӟn|sQ^]׳gtgljY<>oSkF-OK&hqz|SCЍ.&3\n=/Glg4֎>NBjjB|pnnj:nitY㺔۹n32w5^YzB&'<;y# Jךc} +Ki^XipRvk^Qߚ<6:k?&ݙϴ^kNFԵ-_ËǓ[cLO&a뛌-TE[{M' RtVӮ\>\gw`|Qum%D:q_pWљk'aۉ&I!ZZxD4)ewpC$'*b"vdcKJf V*-:c Lr4WWh.o@kNHxXDrrCv3kׄ *Fe YFV̼jލ<fkS98z#mǣ]4N>&]٢LB$w m礳,W3KF1Wq\nbnyR_N>,tէŌ//y+4\5iӯFuNaf\o j3x6Fq_ &&)^bbcxfx?mHi;E;Fǣ:}Wj{{ฝ^=Lu];жc0y:|E9c~xc͚&[Nz[7Y7 ˚wrk')˯+ZXq }j:U/{{;h{+sSOXCjM7љ7l}Yc%3'>r;SZmzsW}hNmo&߇񵥱xǛpsRveSTQ{=tv)M]T[VlhsF#O_ԍ6oO(+P5K3ޝ"*ioiި)Ե|Z7&ཫsiѲ-]R0OŖ(,Wq=L: ^QTXh$w_FzWkז=SM\kRtyN?[4OBk7F7Fo{9sT/{XڛZfInpjD~icii[Rk;WsKΥg?jEdZV@Fєr! 6 AV8єF@0-D,5r2 $hYA 0 H!`dF@,0@H@FTS(b2A`2BP%1JɕBO% V%:!0GIJF  Ht3 `DNX`Fx(D1ǂ -!$RT-,Ң@ L F@Hy"!WSnQ`Dv%2Y,$K$TdB(! $d +Ad  @Dd?o8 0%0 `Pɀ*p 0! `#d >F1<oF*ͮK^]ҫ,k;yn*FջO+ݱM[5w?o,=o>5z%UiZ+JbiNYCw/_ƛ=_c:v湟Q7>|BLšybS?aޓbstK{n&P׫p"Q-)Iw[SY41yFf%[^˼L매djю\LPZ+"wSU:8/ܓrN^4qfި-݊3YݖscG457ދV,ʭ:LoM^>)BXIӋcڜ,k.ݛZ>S 5kWj}I%՛=oM124rsN1WyTӴ놿p\:Osk1߬+vεD~=O}mi1O }m=}g.W m(KK}ޟ=9goy7Ji0#+6-68q7X{V/k?fkV_TrG ?BuԝM)[f÷ϦX8^;Tה5mNߑn5{')|kMmx/3Y>kx.kw|jWiSvf^hؓ`quiΛcO1=z9 fp<7 [\]hsɜlE{.6}U}]'CLKF|;VnͣZo[<Ƨ\ [L6[}}5ˉi[L]?ݧ>Irv\^-|fڵw9Q-_*i31;|GO8ﴱ[1;F\UD2ZkDb1#mC)ZYڧWscy`p:~m´t&-}\iVUf'g;=t}y:}V5j1}ZFϕSJ72)۝z_#sV+EG"QmE*2"'% ҥr dT 0K%B $DY8 d Hd! L2e9#` N@ 0d`dTQ@&  QBh,,PdNX0@v !` ABP$JB0c ``d 0 B  ɉ`8< ,0H@ JCPA@ -, L YB ђK#%nJK a"py!A0"!0$购A]# ` Y,FFQ dd H%3ȔI "@@Ȁd(,?qDA`H*'0<@@g C @ @8 ` cLt2eGe :@d  0@ e  Y7oek_Y0/T–tc2m,Yely+{OYv&g MlF򮞍.Sҍ+Mjë{g{vzhݘM͟\a8c-nkG5خnt9cr4;i8VcҌYs<3س]z39OĘLJJHFgϷе5،mfy2yβ,ōTߢy%F\;&gm֥7]{oM\+ X1FMt\NuY\J=3Mg'=mؒfnoo%33ԭ2=6|o[B&=^_+)k}|q~Sx6ϣ97]D~Vo>y]u[,D4޲g/MH+?S-ՋUu]rJÇ7E^&46nٰ ioEp> ť<7Mm ݞ"tkp<<؝{wjzOxO3ֱ3+6ݜ' fb>)v(]:wt|=fdkk/1 >ҼZ"s>GkkFatx 4ι;No|GjMwD*]ziOgOo\ue㧍fV7g뭡3wcWѫu/7sn"n?NC[OGV^x ҮX>˪[O7vF=4͎K|3p"25]=w4_x:^'ǔS텸.3y}-͝:fƎ^z_&7ojqi5vK5ggxmͻ}&֞yf{F^#W6nl4>8L>G^Yڼ=aLN>hpO5!7{zzw&Ƭ^CAN,DO$rs:-Y#>#rd{};ϸWr(WJˣ*=df=ͽ|~w*w7t[Y":XF!\W8em]];3=X:zmzվtӛL"-S5{jאjrdTV6{l]ًf16)[sJfb<_v77z_z [BiY m z5Hћtcxœӽ=UnuƮj|u8_ik[յxּ׷ef,}~CSn?v'fjo^Wg:ry?:$r125!:[V4cip3w1K0ыcvOѵ_Whq=_ =\st\?7](ڰ0ڵI5#1xׯ]IZ[<:z-+_RmWt֑1g9kܚsM8Wh<~ӫmI>Oriӄ6|絼u+{ůcuT׿]<2#O*mj{龪D#^UrYUg{4;umI秪Εq׈b~*zôsFEb>õ^-"9gzG.KO -h&C8h2ב7}̾J9Yq:mKu{O}9p*7*$HimI[rz4Hȁ"F@ p% ɀP;=@ d$0 "v(t@%eC H 0P % "A P(!(%D$.OF2dH` @D % A:  @@`@ H@x@"< JCVHV"D!"AZu@^Eh6H@,NHAd,-,8$Lr#N#R`* R`  0y##c vL`D 0P$9D 0 ^p#! $`B HyG# ) H8F(  @ B!! `!0@ d 1##d #``FGz` @}y_E[ߖ8m^>[_2۪'c|64=3~Bub~OZӦ?ɞn…Vݹe{3pKDϕz\,V"#@-3`6o49]$}ם/ֈLGZ+YڋW)Y#3?\עS7.Yzm,Q3Zc iY$;x/UY3L)y̦q'0iuKKwF./N=uG{o}"pLDB);}NgvsfW=~ΟQ.#nNe{SgѤ QO4xSNXaJ;_S";R7WO}]ћiiϜt-i:u ;Cf'v^wFm)6՜nҮs'FDNz1YXpwO~ Z]>;і޾>9» s FWeӆ/n.#Ogy{=D3;hm.}Z2]B3oMIZߣ=kW_-dK#m8bZZ frލ\F ř׊M-"ZZOIoj_Ou'ykL/VibygkDK)lWWl׋7-g"I5]qdK5.'>Om΃6tW~{o[=ȅmX%>'jFgteәFb""Qvf%;t?$y2y7kN֛g7o[Yy:I3⺾-^HD8BTe$Zj4 Z@BQHBA  N@B! ` FP $dA@ Sp$L@Lw2PQ( v(ɀ`A(Hg`J wH2 A&F  BQxD0 (  @H:BFBE+rC9G"):T Ei[!&}d -+B)I H 0Td- %;0@p`HN %"ѐW 1(9RO( # ,;0%# 2B60dC d& A[2Q0Y77[b_AqD< Hw0F1 F%2p@0;@ L2(0F@# 8;|nDL}׈ޯ_^DE3>;14ǫ--NhQf374,KΞc8DaSV'?cV94j9LLէoV;w=8-;Z:q9-:i秚ZuxKGӮc=Iuٌ EVˮPC^OF'8smRf#XiZsVtV;szU: Jiَ"֖֜g.-!\e \}.;iVgK{ON&lFgn:jkݕ"iڸfh)joipknrx+4ἛuԄ5ikC jn4--^b!4OS-pz'jpD6|,up#yֵkn3x/!_ +/LVT1^[ qS4{5^fJLӽqlkESc 4ltcbլc,ca-u]Or6νu)Y&ۡqvr?w釅u[jU<ZVmkm+W6ӻVs'^̸ yN>߇tvtVo 3O]ch%^BNzsveդǗ6CSFy_owkf=[˦OdYT3{E:x;>eK[6b3)8wsOܾSڔ'+=BJa*9<0$<`HFpY1(Fp@B F| "B,<$10 S GpF cg eqD$Dd@ B d}b)@N0 0F@`,P @2``Y&F^bskIz RԴV33!b#NmviƵ/,63bsYм-Bi_VZh}g{qx_'7Ne խs|u->{hbx8|.'vioOύTם4b]9-^ׯ,J%8M#m}XC?KiZ۫x=wT!ӆM=я}0fGbNhZg-{m5cJw׾yk?fJzyA,@&ujLe^&;3rWgUF:ui~M=[ 5jajkGZf33=gChړhWz6u|D7uscO_[/6;Mo|ˌ|ym=ތ]-ZJm(lY//j]gKko|Ya+Y43eqEmFKt"#sF|/m9KD{~fO 4L{}=yZ%gRsӖZ|TfN>^1G l{dnf߼goj>Z!JmfMZb',uGN/9ytc=gq[Uq[>U!p5yy>k;q۳&im=s/ufy-^ϣƖ6)X"oHL8ߞf[=!T [mƯUsҙO Ǜ=kͥM65I59v26Ν?zp^^3lu =$Y4oHc.yo9;; {t~#ir.H@HFӵD%(IZp %@$;$ 0dA e02dd:VK @P;2@v /Q$dw `;Qd,,BB1 $$J2<FD8Gp3#D%0! % @,P+ЎY#*!"APO9F@ӷ(ہPFEFQJ*2$AQi!R 0i BpB`$HTZT!!*cQh,$ )Z dJ$V$$1BL `]&ER D'@MJyD%C(+!)FHBC$`,22!,?E f7@$0x# 20@p@pAD#`HA(`0F`Q@ F: L x/OUgDLkYFXgc5K9mO X xC^nɣ-`"&gf 澭=Z͙=} +~9t"{heON"xOz}9tyO^m.Y97|]<4чϮ(k̾mnJm! ᴈsx_ zu|R-F}a-W0l.Q~MLCwƴSzCR\'_8ob "_5_^hZ0ܮkddewc<*Rg[sMvbϽ:3Ի >pә1.?xGMn{Gwˮ0V~/Gj88gw?iqz[Neƍub:N%4i׏ ӷD0{}ndt6ȧXɧ1ݗ>~?K-~ҩR}5Wc=xK fjN+5Y(csus3lMwbqzyg/{}%9^}e,sggn觇u/l۟NѕΓ_gO:'pܦ$zF}zҺcv5f"|m[m͞o=Y^5ɋ?*sOym 96miZfدF~)g5|64D|5j=xx$͋-|ddzVwM Km8Ϯ6)kͧo Yhg>15g[zo56&3ͻy8;LGjrYt_x!N:==cui6ZoY:tr:L߁_>'Ff8J7b#Zإf'y}DKWS<^l==:,;v2ֳh1O=LW6og]W=W]:'dԵxyiYp>-YN:'w&<^WrˏxGG9kp\^X):z;ug=/>bӷwd{~hҸN>vtԄľ_[knݥmddv 20(Q 3 2Y0He A AÅ! (pg(0 ! A#P%r  @C J ʈBPGJ2&2eBRh@d* L ,%0$*2Z! -G#! HYHc0Np*(% aE;ЀP!,tcZ=P$t@ ,PD8D(;p2&%}0,DH`BA srpa7 p HX$ `0#! @xd2 @!v >` .t(vd`0  10# Gw{N]WLDDfq^QBں>&qv^R|"gx)ps]p~vMFQ6˧xmI\dsU/1]M }ț96柽mkQ'E6u=5y/lOc=3o9~}, Ӵrr"Y֭9#ҋgFCv+6ۢKYK45i3nb2+0҈j0Qn8p=LOINu#65h{mQrjR-m|>KO/AW/Xtfsz| Ƽ.oCSi_F55GẶX݋9NALήݗE#j zڕҮdiN٣-_;!hӮeJjsڟF';Cz1X-իντUWW*[xH5- ce?}LOf b:O.c7NY͏dzizn^V>_oJo>S(' orKٛs> deI˛3!3\ǣe&#ɋ9Ǣ{޷d{Ϫ{k杼1w1Z+8eؖm;c{':9]opfη{QիsNq?^ϣ<~7-[ZW}^J:ϛ&kK;~4yùf|69ٙo|]ޮ櫮>:򼧫Kt*+,Xs ߋt8>L-+Z' ΕR0x*i;ތ+r|.mb\μ=~s'jDcst41\ϗ}Ziiۧ1ַ.F?m׮8<|3-e/ʾO=} 1M5&G+쿃xiytuϽgj8R=['M3\Oէwb[?(h|rӞ>nԤbz}R8jZbщzSS8鮭YGWc|VΦ66=&?;nժY|=鏍?˚w3%>Yz3vqV˭kf{7bzylwНuzL?,׽:^/k~w-ۤ3M•M->/`|}4Ym폍n~&}'V\[Z&>GCB'\gt6x]_{6^ь_ }V[Rf_B)'zy3Vv6ىn;K]IM1G䕫ILU?c?sծӯ*6雛=͹1=v_1 Y5NAҥXgl>hfX}'=kkj'OmkVԝk[3>ҫ3ks &~-= HW~mc>3' xOc4uX~zᑣs,dn/O3._}qutb Hٻް꺻73|6$:=h}feuЛOHsӬӈu3n/^tk? g)l>Ng DSZgM{^{\Ht!E H9;Q T H(,s`2F@@ d%J @ ( 80;A Ed#(; dI"3<0 ! A 4SP(!(0 %)KP8C" @Ɂ  TJVB`#NBQN$uK%im0Z 9;JHd *P:A BQ%O+w$ 22(@Pw P" FĊd蜀NtJvNx !"BRybGpB@rD2d@<d282 P#@  F@#-pɕ(@<  8sGZLvx~Ugm^< oq>r{;4VoW.7+;C8btt:v 95I|VWhGw6}wc_pEJͧ2/fmH/Nbӏ(Si{6>+ݦ=Սs̡ۘ*e׼/sg6ܞ?st8Jl6N&~dz]N83/~/+t9_aX=<صoᑹju BO<vCjC~N|% F_Wc UZNF F\nLrvcK~TR,jDy#&310soibɉЀ1^뷫ǼܴG'_ XGDDy t_FiՍH c=9-+^ Ebߟ#NgJ:/9j.Asu YUr"QݗN^u!ib3/mnGOI>&9niK;{_ѣT }| a?(q>}1ipuN4'ŭ:xM~n#Zşm|w _ Zάc|=b>S>..=i{ιd<ܸzٛ}kzLOO]NjW3lm>{g2Zh/; m͵cj}9mqG7J6}z?xL ~ OVtf>λOҴGf~q~/ji'I}"=f1]m^$f.Yo7o"ߞ=&+aOIgWWĴbiG~5b+\GO8bZIwg\ڛsf "!>W{g7Zi@YD6$Tm: +QF *2-!' PC.' x,! C*Gq@$J;P ! uh6O Q( Ȑ#LQ( 1d$؊P,$] H` J &Y@fY0UI`V%# A#pCQ(J 9Ā*e@J#+D$@TZ @6j QQ"eD' BU*4j4ʥP%@&(2aP@ - HWPAI @y $($7$F& Aɂ0&@e`a!JS % *$@t Z;$0R``p0d`bR$P$2y2b2ёdY81y`  )ywk;wGʟrN>wgN=Do'.f}a5ucVUwSOwӱNֹ.~]՞/sUGn;{. ^HhxlEvݾGGckN=V򏜻_j>ĸiVaqhN%Y_f&0r۞}TcQIњ3TcLMs+5L;Yn u虇pkn:ޱ1kqѯ/klLtv 6]NG47ͭR람ΒOvR<mxgHu5bwWs_m1m9ϯi;.xL25ꓤv{aYbbX,qdg,+3yS5ٓyyn'iDʐ Qb+[]\\V&Ig. nkg߽sR&yq ӬMwN)c[\gx+W_uq5kTlrk3jTph}/'| }*DݟWSF;D<?7x= q7D eN9N+pDb3>C⵭ZgWՋZ#?JFveEeOcFCG]9ܾinj+tܞv٫z& E ^ڳH4/>ro~Q'aIg{?5#NK5&8(:3D}Džx޶19Ⱥe V't+BTү5s1g!s08O+\9cK4j0lkSKVi# Ҟճ:qtq6"}LUm8^ֿuKSCZz˶އ ]7{OYf_L87vW|>W8jW:w}7Z6=?M,#96YO[ׯlۉz槒Ǝ{>z\%je,DVc?q:tk:Wm?[x:ŦGu>!n'+vW{/J9q1cGG$FӨBbeu!)BJQ$I($0@$ I@!@p,0("ђ! #%@Hg%P!)O'=$Fq2`[ɝ+c+fZ:FOU:@NRݙڳc+\Jy;ZCkʼ7+Xs:~x6J6Wؗz.:1mٹ\=DLMwVwlkNqhD%@ 2Z!(HՏw-F~DǜfZ;ZF!}O%'NXRB0 $!)E+20vJrCD B  $ H‡Q)$aD8HJJ%R!(3 #P4BPg:h`y!JF#NBp+F6j4BSL4+A+"V!jP- D$8HRn* ,QP/@ AP$+@@$1H^ZJz 2!QA`! 0e"0F@0c <p'c%FdC\ `$u@eq`AJ,% <2`R) % 00$(2020)< ct w0d،#-ZSϝ<&tl_3|n#_-my3O6Z㳣jryG_]ws+jLN 8Hs?w/b~~"w}?OiXŧ9b]]ի(8F"41X>tyq>! bZst3ҿ&#|2 F5zJT{Lo'@~Wc0b씙-I=:2D^3Nѱ@-V&+2EH@"qMXXmc0_1eq4֚Z1 )"2JyHF&?Z"#l[6ZFg>p'>1f%+k?=;|q8_}>#Nk15&7㭥wi߳'N4kn/9>r8o'/ЛRg~[G*ޥwoCsk"oO t8jGW3j+ۘ1so7xIOtScn33T- ׅZfSZ6uI.5cmVRL8#ONԧԷ=_C^tfi;)E h ZPm ruD BE*Z $d`! Ȥ;P @d  A@(P 0;ԨJ:Zcqrݫ3Jb-ڟqU^ӌǹ-ĝ}֗sw*>:13.o}=9VRvayZɛхwYVd˨|'ܱx%wʷhZZxV}a|׏z[V[Wue˯昝*~ø1}t7I^?C9-Z{y19heVy4/Dľ[J4^1X{/upך6 NZOZ7=fS/..״3{Wcvn\^11^SӫFF'NZ {ǖfn= bΑ5k;n׶glqz昉|9m\˿'u[L/N^# N_=)iaQ[LC} b7zGuw~4x>'{^"4漞owW4v"ϡu=L|E|/[~nYL}{7;q[הu}fR'vyj;tLKuxS-x~ڜqxCx <6qh NVg/髬=~+D6iWb{qq+˰ӫ'P1%3@, ȣ@F2H2 "@3@!(J)A$(8e (YTA(BP8JQ"$hĠ*&PpCU89H*GJ4h t "HyFJQG@b:W#iZw6RFP&F@BDaH p A](-v(( @8 @!c Ht.%r8@$e@PTH @lt X g#$;FtT#J $0@2BTyLH/Tx$ H`C ! t% 0  @@` JQ3 @e Ā 0X0 ?)nq"/iHq~__I}q[[lp&zqOf-=;+X˱mǞRKˣ>|9YLVu s}-^}OD9ygLt7L}r֙[Nr^ e pU𙏋mJhNLzo~R 9|O&}s},h^,5j+gg1Xg~Ftc;DN Vb;o>ș2"k6`jeZNH>Ֆ]=)fZ` E)ʖr6c [uc qNqqzͧ`Dre~iC1 d u2P9V։wVg4fww1Rb"v܋F?;%=c F-+LOHO,LzȌ-5ZҙfU `1F97Vcbwd soy"'Xic;];GOޯ9qճs3G-o_oyrcn3xkV&'ϫf=泻wm\U>j&eԾxZvhvg QJF"ھ >pGhn[N'9#"z&۹;u(gwcxe5yN}:}J{\~bQf|g5f'>[y^hY} V/Y˯觏|Ncϴ^C򶭾NV:Oc6~:N0=&quJӬCsBqm*sgoKRt&zZwtя2tݚ]G O\sL[~+Vi͙2igO[^y}SV{ԙwmVZiӏ_ͫ[NҿrM2/[:L|r߬sW7ŷݖL{5jxj1c֤ͭ֍8NfsNb#oD}X8Ӭ~ζp~\vV> >ٚsuzNn^Ν雫!sjsw#kZ䍧ozX눊3ok7W|v"$鸝S?QLk?z ^__Uhqtfѵ7#szc:p5ubw3D޻|=?OUճz| nݓ;y9lRby3zSt-HӛLg׷ϫGƄO\'fNN/嚴w\o^NqEfys9s ںں:r]vf+]po={WOYݴy=\64njDLº%&0iim^7_{ɟ"#-Hv{|d΋+" |΋>>ؖHʜWpVb}ZIRbuӫ39j8.qC.g8Ԥǫ*GQH! Bd`2 0 @`dI @@` $.uaEۻk^_򧣘U"&[|>m,4}Yf6aWk_ܻ%_=%X\{;mkG4Ll tZ㬭"!{vWJ&W\-[chnOƋmr20`rԮ}V#ե9Bf]-џO(fV22GI*ΞecoVM4xKN0IZ-;f='lb @mgɟ#Z3V+3k[FC 6`֦c=1>gGZk^n֧5gi##dpYI=GX,֌L99~ tcǠ+P]էb]urՍ%x'֎m%q>i1.MəYZ5s4/%V鼹ǩ~Vj~$nSӗwO<*zUsJ\ 5Td9DC8q ʎO BG !iVM-( Q RPpц8)A(% S<`(Kd* NA iD%0$ZvA FFB`eFSX"u HbAda I I d J0X9H` !d"@J!%. 0 @2vr@GR@䌄c9 "SLLR`C#Le @YL,AWbLəFYG@2 #)# % x !(FCe00A D Pd!6g6%ubeyW;;X[&N!{/ּou~G֯uI{˟j;e_B#VyG}iibB1ךӘwycՊՑ /m(Oh˻҉ٟnO,լTNQgM Kiӿֽ|f֤{fŀݦN&w/"b~8Gˣˡ@(MJޛD>"3Nw9#~`mˈ1ՋLc4V՝OQ[o?[%ً`$Viz+Zgl,[5 8cdW9d Wsbsv0@"q2c*"'SMm=$zǐ9ՒbOvXFDD$bmRٙԙ]3 gf&'7/3LBt+p@yZ!5z-hcyazMb/`R5'38W+1Jg~֊N<֖J9]\*Lu|6Vz9 Mo NgZ99]H/%9 nMգW0@/lDF*Ǫz\U9ӫ~I(_o|(5Ԙ'Ԛ^~Zq/ EK7vj8]kyܽb2/O)7|{{og&RjĿ]vgx&';&>*鳪}[_X6jq4m?uzY'k{7uz;D7N5}z|?/,.kS.xðC5HƜ~,t}Q_ z',aέ>+gơD KVwe*[5/z9f֋U&7'{ϗչ74KäX=6}ZeOl_Ngh<~~']].Ԍ{}}D|Qvr|.-Ƨ^j^;b{J7ޙ;ͻ_c?=&g_d o Ow6:י13,8 NF/IG,LhΤEN;u|jw]<Ӽ薽G߃<]ۮ˄-kvڳ19cҝmx-8";ò Z|\ע2x?m[OqM D crp޻w17z< D>4f'~1Oxn#}~egRy|>W^C-y;]Tx^)ᶞj;G 5*F&"c3VfoGH^|j^֍ٹ\%}7{38毜>n'HpU(HҠ$` P'@  B@@ d% ^E7DHc2. Zrx"Ώ(Hm%KKwѝmXe~J|R?c<#Z5mDNk#[uk=23"Ztsv[A*X_xZq^hN"T{OuV`u9= ՝I#x}nWK$݊#ihe8԰G`9nho,voZtYiAH7ԞVYkXը# kۄ+hڟnΤ}M[Fئ?c={Ko<<[ N"tsn1?7]΋^ tx1m{K8SBa<iڶ<4rDړa;sWzȻ#zzL~w(@zȀdPg)$M)PD%UYJ%Q(0! U,<ؠ@J!QQF%n*Hm:!bN%(C% S$L eA `$)XeIpHH AEH/QD i (w Y NR :;;@ N'`8@`aFSvN 0Gez f `y) 2BP2 @@@xp!`:! ]D ~?Wh2h[ZZ秗gG{wř;wU-9;/+ϓxԌG$S|<7DD}Τ잙WZY*5~ ↑zumMgVUg]XY1M+X>J}r-;fv!Dʵ3엤aH61 GL6&{HYZ|nKB"(+[Mg҉/9<Ǽ@X RY~HZq*b'lB3m;G@[ű6|+Ξ~?IjҕHD³}Z+XH Nq^h옮:t2]"|fzIMQ{ǩkM`z286ʵL>J'1 H[mEwW@ 1i'#trI_P=wV9+9 d b;Vْ-䭭i_M'tL lbf:lɼ+31@>YVN=Q1;uV ݼ4z S36DiLGy^S un ӳ-"3;D2SS1 +8V&V+shd 1;0ZbcO^ciF MyB `ӤZHgZk5jCVӫ=|Aj sW'oG[/FՃ+mGIVR̬8`E7x}\Ӽ<嫻;mZLnq,YÊ#΍b;;:7/ ZcV;8߷>{7-^<Զљ{ť7{Eo\}]jmaϲ39=esnI3;Zcz=uMΞTr;'>NiR"kOn;1w5[vx^/nibۜ|ou\:uz4Z5Ë[֬WoNӜ[94z'%e\'=t&6 ;N{|=Px+DZՏm T}VǤ&w NZṡZ&m;f:q<ݽ78,sj۲jg3tpWDŽGgofd|"Ύb3inE4ukiŌqcp?C'zb~%xC:ߊ؛{^>/wu}>Ӥ9j>bzb>Xczg | NGL/lt˟6i;Fm9Ȳ꜖]>z{;=f{b33ytޓC#V8Z#i}&333w_n2#|_fקկc(Cvk p4Xkb") d IG@*%g ` 1gM8؋vycsX@KSWB/_d:z릑,VvWw:ntkzoL˘y/˚zb8fq_ښwӶ-ty|{#xfb"tg|Sӣ&rǀ>|^6.  @;rL!%9rBɀ &@d i0uV/6e|"|^+N=b&S mkc k2e?}SwXijrHbh3WCFϫݥFD9:/x;۲':7e)1"SF;h|Mk9qSN?yuGיLL< !C5p w2֝i\k7v88sc >|Rt3;-_j]}3ݮ-H^8RKWk[=}_i{$le`icim/TƫPM~N[c9]nf3.[G8ĺ5eڝ>]m_?ûoԎOGHwt~?4<𖽻0C+xֺip^'H֥-j@%q/xmER8fXtϴ7KkV:Tby ^?Fgšqi:{#^ū%]s9I6s֤9 掭-IpVϼG71]}m ݻ}psWGt*OZGu4jVqc;,Sp\oyyy{ܭNJ9y}p:ςHJ P ` P9J!(%(0VPJTbPJ%Ҕ PPDJ2%P8PJE#B@)T@J!btQ$z#RԆG" D,HԪ6 DJF@ .HI FpB@@@ EcFB$ޅDd` L0,dm Q !3e1@F)dF@u% < % 1FpBPyN0FH0}5y˸ `( 1F@%C%1 `F})@@ ٤y̩ųsSW_:9W[hǩll>_  n+^pQɈۿz[Yz NNzx8R"yvg̓Rs?>1f˚wE; D֟9)9'=?;_SCc8 bb~b< 1XːD.lkDVZz+[M~ͧ kg޽VWE@ߞ1׼9:E!h^u\斝KWv'o 5+d'Ns1&O,Ͷi+{ȜwV)8^"+;mc??zuO 1rb2N6hzk@^R~fH'fA ߚ#T#*?? L>jie1r~SNқwd-S=#bf# ޾RzH2u-z~Ӝ22b0G]'1>lw1)"3XD#O(E d DB"99wf72"6S@ `rK$g sbgLQh")19 d R&˟~|L~u+NYn#i7}em}=j&5mcZMO$d J >jR5+ej3 dY3 S()zEY}-6fdGp(2$CJ Du_DDkٖ7ǣht_lh|Vq Vҽw;W 9c|f]}'McN]ʆ_+1]$nK|"x},p{AIs\ONCou8"״]p3D60gg pjq}332ũbUi)`"Y&+̧TN4dҞhG3Q6<B cri}Gz|'ZV6[7s]W!JDﳔћSK KhLb#ND|J̍WRՙc')ӤtɎ;WW,]ZPЊ"chɫ1X[:StrRK3[ m Rm|vbԜO/45 rX6|؏h.%pt97sS8;jukޱXq-Xkiiזci#Mz؟Y4b}:md/ˉYmխ1SBku@3}0 E ғ1ki܉Y6DDV?{eLG$620tR-+ZZ&%һ~HmqUhnk?`snEf<WDfcnY虾'9Wq,]}6E+y>)At9c F:)m;c̤žcn!O4V&@2LcgR#Gdԯm*#ԛFztV;cd]KW`зg؍XkfəF@OvJaj$ BܰZyviG{zz,ul=MWLӮ=ח]8ĝ}y;>:J6tu׊8*͹"+iϧOWguq:x{EosGqV]3߬|O~vײ܌<λ}5#WSb>KWWZ3]ghqF&b)-6Yl[>V皯l=<'y7Von4 ˦^\b8??Tts{WƝ+N=:Fq]ۧ 'ʺ/N`V !즞DWy;ǜF!t}:VM3V#xق3ќHI@g(@!#tDQ@oz93*ͭfsN7D^`Dr`YvyzNEW ]ZZaֳo9&5ߞlR,9y}x~R3?sdP%,@M8PBPF0(2A7V^LB;#˞HsW+[iJ&pjRm*V& 𽹭C w;Fo;.[ٿ->y.up<i+uDhMCq78_Ezеa94YPq}7!-WyG,0GsAW3Ӷ%/h㳔Ț#A^hGIY49)D0tvc??ںc,f it9M-܍#{f7r1L& W͹?s4>.}}L9&m=GA6地hEyl_ͭ8}D^kLG4!0 31Y)9Y0@#Ҵ,:wVd63=lLx"fiю&b~Bؒ201Yq_%Y)Kz.mج_9 eW<}-im38Mc0VZ"b&sW+t1VfܸnLV9q*1-3rHZ3ZΦ;fJgv<#V䎛 LVa\ţ/X՚O_zkO@6cKNbpIf} c0ZdO.w~@33'l"&620#0Z< ^0Ma:b{-y\q,,5^윐 `G$XJ@J@u$ re@ :8D0 J` hDRpb%I2m2m #0 I(#ybs(LQݖf2z5ݻݻy'&"޻s;18q_ RkhO\_گeu|7RoH%ښQӉҶ19uԫ^k&,9yG{]'W(e@8S 3;(x!`B QV+yv{BFF[6W⟪U%ӥsozOIs7w9%Imgh~>R"_ϺӈY5ӤO޸y?gkگq{mꨄw}?Ʀ1OGf1 xڅ|ڱѱ\mhclh/JîxY\m־ZK&;sRД'!(+)ӔCT0lr1a, D-[j@^2 eWZ%Tӕ~> 22HgWjӓՈ &īɧnzZ;6ϚoYӴZ:w]&z+=]=w4HӼZ>rWӎ#ۭz} >7GZb:Z>_ 9f(Im^n|4}KE)/ۣKӝ㤡eZu2M-1=75bas1n#&8^M^-~ŧiB^-׸ZtkܵA3)ԴLWzks|?͓JkmMW#9Jb+U#O,VfXoZͣizgݞFv:1nA^ш|rwpn&cx}/Fʎ)36zLm;#-X-p&&w3YXx8,<ʅ -]}ɐki-MY?O i(amX$vAjG[JqY`մc,)#'Omm*V [sc^"m6kZu[Duj|@lV%WJ3MoP H+]~Ҹm0@WemiLݾ~;M# R60s=~~+~YYՙ8@mb?WMFF@t)qX22Dת&~ߥ~X“33`ҜcO<11@3j)ţxVpdIIi꘤GZ'2R"+kByZoV#++LsD&HZb&2R'ySNVm;k\5%_\iL-Zj3VGkd,9R`Ja1$~XD c!i{BۯX( 2aɈ9Hk3& '$*# 3Ȓm0g hGI$3(F`3(2Fz+)BО`&q+E,JJiH#6ݎp"rhX<󈉈ؾxto[O7$k;{||.ED>/ )&_'y>?+GC{,]^ZڽV^%ԺئOVfb7h(:`%6ՙ 4ev9C[τ%Y“+o `%] 4J%'.Uju2V˅S#WrTq R%]Z1u% ٚ\+ܸbj_lC-!Xc Ԝ1xw3\GdJr.-t3/Z-eonzOx+/u)x}c} 78'&H9U!l&&u4SJbFI*X5ՉVϼ\0iLRi?^B45&N@ nLhFO$ژ ;ThZxN%Bye-Es{4MIsQzahәjjʎ/rfq6#t/wwg.;N7ljy9)5ϡ:Q+icaӊ*[P7 zdp;կ56u'ߟF<'qWLN|}Q\|JZf' I<m3ZkWɓi1X"1؉̱jcc{g9Q5V:OF0gZ&U+K蒳 Ec#hӌtbf&:w d pFm-_jӺ,yCL+<d)S`ۮC-oĦ]H_B)` @@0H8FY&!\+rdrɸf%#2 @Vg(&3=+6#)NȌ(g*۲8Vfz'ne`B3Վ`~+BsY0ڬl/bm<+nOUt=ɹ3y>xoWwH^KLOdhP(!(HI1yb$_Nү;$5-}jU_GKs=[1 h`ڳƪ!OIWF7{X6Yt)8VtޅcvIռc?Gf.ygԣ-UY}g>ׁxns1^ kpҦ؆%ӢKbqB]WzVםz5O9Kxkkqvg9r>k}-<5⽁5'b0upz6~iYs<&ߡ!0u8~/Bf'9|&x ;KGָ>z[W1+Cee\KFUkyGys_ѯo^&WfCCæXf0~%s[K1v]]x׫}fjxۚ\fz)^' *niqh;7UGk'lwkhxo 9DZFV"F☷\}J13)iܙ}Ӯ sve<mm%i[soю#նM}k<7,qSvf%h^긟3{S+5uꫵQ:) ̖ZWu̦:bW19ҽ ތD[|=f^tg'D}/+G'GcїiB>SxqhGv-UjG6`G# =Zߧv i׾ p #N4"kұ9hr:w'O5(> jO.֎<pzpտ;V9JF4}t,gŸk@xE"7]G3p{xX\UdV%L/Yth}]rM㣨5i50'P@PHZd: 8F%J$`a(J%Q2NT(3F!"PdJZQC# @i-L#UHiS L*#Q*(QE(JPtJ ,!  Oc!BHX#, PB@2•%(@؀(G@HFTguHl A0L@I@u,њx2eq; `02- xrc&@ 9 <Z9Y54p\7.|zY^39.DMsXhWi;D9M_j2u:g>1==XuY掞_8ejs|3^4L0\wgFeՉhiMcg}Z2 CҙݕդJc 4u-ThX>2D#-(9 Zcv{g M/ۣnijV3jLoў;k1j)X@Ӎ;O݈z+k|^f:y~[##KDEhjٻAgvM~x\JbsP2()=ֽR4&>e k5bٌnr#ܶ@+SVVLR0^Y+yXZzTm;0 9Lbqj3(b7jMijnF@LhL"&bw"69p@'B'F33<̶ǒDb!_ui]KM\-11*jVo M1b f=wR#}nɛ^e3~60 EZ#ɍKgkb%KӛiLLR/8`0"M1 m f"uՈ&A#91;|Ǵ N;{gP8i%fGp֥FO$*h2%PX;U2xI7 "FkHaҧ5ϭoۘcqc+VN3vjxls{־rխyr\t3}׫CyC{=(o1D95xŞf=w+NWytGx.6yVzGh Yp;< z);W]>Re1-7ZMɧz\>moqxEf:e{iOR'NcGOn^Nfƞ\bGn|ai|S5FwI|Iĸ_o3+7.4e^w˚JaY^wm2טhopfnw%:V!V6hҤ)lbq~X<_$y {WzVY/;8/-L򖖄u"+|?O M?ǞQ>Oɾvӫ|V+ޓFLGn ^ϣU|q+7H+6b7_i!:^m3>? WNua7xm;/3t8/ 9wzjs~f %ԕ-'R'/{o|mlKSzݭ\VOɪ L>Zf9o9x*sO+5d|1NY-L>\%-8DY⸃Zˁuv&C,BYcidފw4fҬgN3"^Vq3ُ7VQ._C=_1Zgwʌdq;v1*s^y~v'g?16nَKXh~ܧ4unי$R>;Vc%۟Bs2ORwfmZGYwp|>iGeoG͌F]kb&#dDu1 [AF+i&ch6M :޳3=֚b59z[MJK9M=8glhk5O_ы݊:;} 3|7ϣkYGoPF@ҌՉO˲= 4p<|nR؜xZ 9f;-9FgpF-&e191= @0Lu%§OѶD+Ѣg7oűp,٘L=q\~Lgr=㚜Ng᎐/e+KFZRF5h׈Vo\kRk׏P<質Y:u]wfVf8d[bYx:5"jZ"V&djwwUӐbieҮ!zϖ܅qVYB/)h>{<7zlF:7a'hDÖYӌ{>㇚mc7TRr榿*f28-<Vu۷E\3ulnj"Ոf{AWFv1l>utzo:35gWZQ$s?.{Os&:usm=\ςx3n8pZN'!ikhΔDOOIm_4ʟ&MsfTK189n9bxuS^d%Kk<ͽ-L(2=է8cDʙjdj~\lLp5;\ ӆnI3Ry\=zKap4UjXu K|>i L^48=IZcvWO;=p`254=|-\e&Y22šahި`cš+cbz5af]o6p7M>VZ\OZOb_?:\wJVTkg0t)srrǒx ufl<ܷ;K::F\="rz_z<.gyD50hxX/ƥS0_Ѯz^ gqomWdt ׵' P!& JSԠ$!"ɡDP(A(%$FJ(aZ@BS JFzP%XYJ$d %TZ + *yr܆K#  < .@ @O@H-)P$vP  ! dP `L`9A!,r(`S J`0#bLaeq0@@Q Je$ ( c @@ >($F;2`;@ 8C@jVmh~~q4ocKZdyKFZnQ3vW/|m?t}p i뉈ixGNӤGc?Nz&>~ıdU]LW4aۼ3].f7lάͳ(o[^S V-)Yݧf:-:SLKlC7%ѭDb1ڋfu`ܳ+Ŭ]%x|fg<=m48M:ΦOx|ԀӬc +xKISqXФT4fimcfi׼Zgvir᧫C A[NDW?Grzn"?w&>)果D1tDd HMlL8JƭFnKW}]:E9|g ue>FiVfͦ:Drm1Yߨ0evS3͏ִD6 d߲;9$ &"#c9-y=W-1svH4V挦z@ 1V>iZ&3V'D^6gc3z|B2)9fa}lq{w0-XhḺRNKE#A;NC5"#}9;XѷB-[~;$DJ&Z+1go9"FO\g c( N3{LcN{"b2yk=HӬtL_e30/$hzGDVb`ȶz0+8"b,PF@m&v1gr3əV3#`JU1'C8W2@lL's3FLIbrd 29)2J&Df -)+33038&33 )N3DĤX"pBqLo'Ht2J&0OB]q75O xK pyݡ[Fa|N3D=L;3U[Y"s2q6ڑԮG^4wuSUD R3hUB>$x]8=Zm{e{NQjq;V}OK]u<+rj%Yr1M;[0x]ԍÊҮexu7xV6YWv2xVfm =99}Mؐ RRcն'` .KG˜WV p2_IKϥh|V'̸*+<~[f[orÆŴS| #8}<ޝ;1qqͥS+U:QPVgu+R|6]P<=SN_j8~ZM>{ĵ|{Bo|4\.{Uko^zzjyÇa\~6~zJ(c dp$JSD@)QdJ0aE( IʔBP%8%GF0Y)d BPTpPh0QR@%XZԪ4BHԪ8H!EV%aH2b$0eYʀJ#H AJ)`! Dy)H]Aa32 N7B@PQ0NdĤ Fp@LA FNø@<*yP%0Hs,)@A"$2$Ŀb28d'Se@0F@ #BP  `  t`@`RpRS20H Q z^\F6;sø9?vz s^F.vSͅ`j3士6H&fZ9FyVXqY u"ɖq=iyMhYZg?SR/3͚Vm8zYY]Bevڱ-|[5[t`ݵ?4 ׫f&c}oӈkV~AsORfwݦtFͺt i!͢>M*fьd=W([B-znpwӟ_6}b1m(g073FbՌ+5܅jm 'V/N^L<}ߔ/53WNkd -u# Dӎ[6;2G&i^Xk^| V'؛ڱ䧼QRmzޱ#RH0@Ms۩jWȬZg{g3¶q8~$kl/5LbpE=Y&$'7OV8r,&4n:JFY@0bf,/hao33"+xK[mh cE?5Y1WV؈%2ud>x>QYZs]hO"ghO,L_Dړű209[s[׉z dF&S8텺)$L.boz  L!e1;1hL SgyZ" @R #%O) `7#F3$HbS3DHzt De[tN@TNH ha H` X+!kuUwC.c/]|eL/GyӎĽ6j7GxjL-Szȷ*uJLq=uCvZ 8aiuﵿ)Iwֶu]\MHԈ}Ǹ>6>x~) G6dIBf<)JbbU±d/CpnrJufrWT/ia=Peh ]YUu W_""K^W^FS5TWXdݪ.יudC%!çmj7jrXV'-*Da(y\[wQ(֗Lb\Dus,LN!1 |+kC4j3/з/N܊c"FDt2# vWe5 %"tˇ{h!'4խFay;]ע_Wf{[ixҍ.2;D|YLOgak&֎ yF\=GH P2=0BBID%JPB'ЉJ)%*"B҅4e%PpyȣF@ddަ] BQL- BrTh$E"RI d &Q @SH`%wF p (%, $h!! H1$$b7GBI!q d J0JHAGp``F@0d #c;0Xrenh9Co8%0C#@2dp$2`J d@!1@@` 0FCwN_kVؕŸMcՑ^8USZyypKW+8f0^m@D>D1"r+yDF9u6+sދm1-4:0Y-bfpd`v/ +Rl0eDnb^Șd`f+3$ŧu"c>k̑Xbtb:ޱ^o:V;#Nw-X2g ⳼uZ0NXW[3q\fhwšqFq^u1bm)=H X'*w迺g&F@Šҧ%&3U0LZ<ќ#n ]o8'> M#s;# aZ 6ȜdA u&$I鈙G6@ t&tMc&p`ā@DDa#8@cNQ˙3`:&#g0DJcL3 (%A+3Z3 SZurܺG7}.ܳͻ;]0gv{G-:<]1HFmErȪw"W|4N`f,~3jUou& ?>Mytm^f>Z'mh;By3sGLͮ^Vٳq}a0/H>R&m/"m>oՌYfv^wzӣe)SOO2kXҮZs7瘆{1wg-Z2?0V{ԋ"qZXنLvxzZȞI뷮}կp˭KGnN*ҝo//\f˻zY[gE5bjeޥ.wƸo 6k0^"wfZߍ;4[2_k_5DJѻR ZExyR#V-(ʹI[w{nU\^09-hj̨kUdL-iJ5j۞ukZ \rׯf@D6Jfzu=;WjԯV%Nָ̲E{u0PliV-.g8֓/WyN[Տt}6KN#|air6r#g n6bgwx9] ::_8o.ޜò+9W/f}c/V|n ԧsfwN&5#ӽ퟇给[m&|Km6g['DL50~gՏ:/sƿyNx`B4'l-^j]."|j3 k.C#ՙ o3Z-/^js:Sj>yC_'-]x iUiIp==s)onzώէ-aݞ[æeҜD"| YYzuc嬋2HƤf;)@%Pl$0$-(NpJ%)P J<!iU)NTeH,Y8%% `@jv` BQFQUVQTm(Ң- čI Zh!L;dZYʀ:CQB$@ 0D%dv'p `) -0b ! $L`d;  aŀIxdA &M}'|(GH2dɱVd( ^`@`, A02BP` `FF`@HP Ly6y|msSȼT4k20^wspӯ]KFî:;"&6tsWdt|o^J*uN"qbӮՓZgS' YOoZ̞32կ=_JgJWN#|ϯksD^+9r:5DǗ˔0B Y'?snb>4\ff>'^kXً9=툘6-3#^zܖ1jKկ>'ϓ1vp<=kyK+@Ѯ0ݍᣣT?Ӊq89rLLf\Ei39*@sLF[s#Wmo3g%g6=Pb՚08I}~<#磗Mb!u/!-kN."g1ݻ|̵55cOrvт؈s JLL97'L"b`ԙj#ۺ?AشZfajVfr 坡Zo^՜Iq9寔|(ݗ(;n`'9E6K%';J"kl#V} [RqXHLSRb'iZs# EmUٝoʖԜL0 t"gv();j#$y ^1?j9ciŢq3?L2d/يM-6"1-IwFm5 f'n>vjޱMmbړlL}~mc d8,E7l T',9뎀hLjL v d w30XqО``z%3d 32oӉxwF3Zn sGD:6Y]Y# DN$@0Dw0cDg0No"!dF00"1  kNs؍ҙY0A#@02L8(C%z.I@ ÀhdVb 7Mɫń}a4xlG]3 Z牎[;ޖMS4r^ՙ"rζ^k=۟K>B m ]m=_OFcqn&o1kjCmYSemoF޸ڶ(7eZzj3u{{9Ǐ]> (%9|O=ښG5%Һ2n)xeE̹;xvZ"YGq>yQ-)Uq)Ʒ wt]!ծ*}h# 1fd/0C-Uw w5,խX!C%a^FIkׅ;Vea2ҹCsV:772{^Bm zUnRի 5jլBeZViWVFr|0N1,t枽 ^0w/qD!jS28XC˔'7t)~z6s2!=V5"#=\vmGhѧܳngBamk{KzV֭baiEubd7|uɜ{[' ]09&hx.όqZ >3#^ٗh}+zSp$3^/1.CыS3H길" Ѯ*hھO%[7=|Ritǜ;:#B32FX7uc0#Ky0y \S- }~Mɹ[+@ؼҍ_Չˤ5+*MXz+_d卻닶dYC_4012>C d($8dĥTrP*% JJQ(HD He(%JD,2QB(]̨--m:$ t& ;"2!a$&V:X+@C0% `dX2> FLTd;@vH#> Dw^LȀs@X0$3 %f B0ldA!NQ$ȀA(Yty$ @0 ! `J@ ` As  2! 8$p`  @F@ewur}>zq~W錿,ozmWkKؾ4?cm>u/H'/X{v֞Y:9mIŶ::s;ikE13M- D2[1i/҂xzƭ+Ռ|1SЭ;Fh363D 4%ylVk<@J/k3h}՘9Ok=_éSO8+ӴĹO -Jq5|y'{v^9J_9_E:cfgdzf9`#n&EwԍWMzh솼ֿ{\]Yqm:JmaN6Nan\eҦe]ti (C=kd63FnPAYeHK-v(kӘե {y@H h4b̴地6xlz.'Z!\tDz>ou=T⸩Lgn+2𼧧{x˯G,S^3];DMx$l =..o=#z}foZ#G^HknzeŽ޶ FSCm{"׉t|o4V}y{~^4ccp,v}Nɟ})>gSX[|w?6cǿrƤ<tf\~![yKcgv|S}uF-]XA;v&mjՍ/]8׏)HW8 ?pFL9ZMO$|~I{iӖ{>Zf'ttGۍՈG|j1ͺOu*lڕtDf}aSk/HǒKPH@ 0HAFJq(HJQU=Srye aSJ`@@AHӨ JVhԡ d-T LhI ]K9)Jc% *3` 0SHw AH%hH;H` HH@ 0 OT 2@ 2w' S*ĤAɜ+RUXl;!$詒>H # c2]gdCtBfP]D02@rq#@0# @8dc 0ɑ@  `F@.F PYkb--=L]?=z$E ԈI+y=?f {1rh$l_x(~rTӉÍ5"شO{fb#pEɧcj?Wq}:Ùb#ћBֵh@R3 qN]>UF]:*%vl~r.k]\L~~ }_;;9 tq6%GMx]FysZ8}R4?sB3ե9t!6om_7'kfzmR(6.cBؘL[f1e@9=z2WpՈÍ3{mZ-73PLNgOҵb֞4"ѝ-{ϨϚ=1o9gxJ(oD<{1sL|R.'~m=~xV'f#Z}$dsEcFv90 L2&s>`mnieb'*{#3Mgfjoy3Q AY\U Y;"zy;N`+Y&ٷMٙ>~ `֏/Vx11lFj'u+$M>⳰2b9r&'%cђg@qi1f9LFrb}V2d-9&pm1FwM/߻$Z<&{Ā` 8{Llak[= i喻6'7`"g27Bb;"b@E6`b:/6G29 嘔L)^g8#3df0-Ɍ+nF@Jf30Y옍q0&1[6ē9)2F&%=U7YdBռ.R&@DĤ %\ n|6'ع/Rfe4K 3;Wz=#b+duHF*U dH#G'.P! # 0dBa,J*,2Ya06@H GQY *TRJ@ BQzHP! T`ZY wH"n ct e9FI2 00e@̙2X0 FP0 20 L! 2CX$@`&Q!c$<K0  2eB@ r C@g fB 1`xN%P& L `: `%ݩt"fbc8r;t+GztkteӮaӊӾ[zZhP [c3 ot8ّqns-*ܒ pMk}n?K{Y6+'[R3XpCg#lCCm8P˂& Zrdd JLGZ枧18 +36ws55":( *kVo 9 #95s˲t-n,ִSɡK%DC-8#LNƥq'-nRhs%&v+p10$1FR`&0ur"ABk\ʣ&&` .%>w_DeҘֵz26xr5kh^c0ٹq[/CxBbp )'. N7'hNNwvړՏƦ%nb0O{_7Dtrg7oFs=*s,z'WP$ӻ_SZ19CgfڶgR˯ a}KXYRF^~ zԡѫZz6&e^2X@jM[dL 糷OE笭|b-iD SlWV;b^75可VRթVV 2UZ+&PCkN%3-8SXYXۚ!Ԥa\nVYV! ^bwfs9CZUQ)ZoY릶}-xsOPӳ;jΖp-Nn[2Uiu`nyBm5r9|u'Vr3xb~] ՋZr>:Yo'_QLۿ;Nuje m9l>߅CoYΥ wӳ2|{\i;FLCõLDfeME>|kXwFg@0ƕqSWZ&q6[ SF g;h2v$!"rp(2Y}miIūZߚe\d x͑Z'KLV,ļo\3x\4ӧ2<&VjëZyLt}g5ڷӈ|WZcSfFKZ1=r( ꎩ`w0# $@'˰! D)NPBJ&ʉ BIJNj@!"sJ$Yp`$@JDHJD HDRNP!nFQA) Q %M%zP  <!2 @:Pd !8$@`R0@ I0'(@H`2;(`0C0J@,ɀ{@B7@:@ < ŀ2`L 2b@HJp@`F,@X;O 08_6#~AMN}CRݳv[pvǃo=:1G^vzu[Zb0#_NDM⶙nt30Ezj翣.ښ럵B"ᱣk9vFX薤5\rZ3yb~~Ά5-18\[muԤy-Mኺ[wIFه[R"f1C,iTZc .܂\HSjc̜TNeMHbztm_7%JZ1䴦ppT;l9Fy-2dR qic GVk;[fލf1y n҉وR}gzajrD- J i[zjWR"GoF+m-6ĄsXk_SV"~~}YicGVӿB{Z'oʴվ"#S'G$D/:|>~zckg|dI vM{*Lf'fv20yjc޾z>FmZS1&Ӷw3͈)RgH3Egfk?KVus;o֤N{|2IZZR3=>}S6h2KLvcZ{Ę -Ebr-='oUdd jRvI錯kEbTbBx'|1N7[iL+mTsO7_g`7"bzvZSjG~M[;J+^X&Ѹ DX]s͒<_ZTŦe1X%# #@<՞#1xS"'܀Z q00&g+bbO&HYYgz @Y=iO5$`BbЧ%qd3iɴFň@20L'vNf@lq؏ Z0e\LFLF1VroE`')A` 6' r$#22qUdOPpJ荈p;Ev%]$Զ"3DD@iũ6ٻ4G-3+]Ermn|㳌>w}^[vqz=ף7Qy?%x.FHL>g^-~ Ze\eu;KO~5t^[g۞5.v6/oc+.Lge}kZw%Y-l?N 1c'_0ճa< ZjFB|s-rZrH&ҚRd4idmL!0&ZӻdjW5nt]Q juYSjdG^ne=qFJR5! lMKw55eӦ:i[ztWZueԣTBLb2٬Vkֳrዽʄ/Zf[zx :p^\5oj2c[|~nnshN~񾷏shvq^pYyѹGz.?S#"T|*LybfHf{)nZjMeR};`bbgu'DS7[vFp#'1[d 90wݖeJ \IJͣv-H[OĶ5چH6pO֊pיK pXy?fM9kzTɷJ̐?׵E&Yͩ>hL!r$M2`! $I䀐`PYH!YG*& L #'9P%id%r2 $j" BB@$0ihd`QD$'@J#]Hg$ BQ" )@ 螨DHB@%8>!(@ $$F Cv;   S $$Bq $]ʜd@0(` @9H 0  `D (  8(`+ϹϽν9;٪VsNZoxԮ5Lx|ؕ^Z0 1 ޚn ˙ٱ5Nst^-5^K5"fW0ǫLOcOkcUJ6=}; lDcլ[W?>\4Rߋ3ԋT@)x1 b1\g3,HLlũq N#JmNm۽RK+nhM[Ӛ׮Zsf~~4 Byw'қZc>}\A@-N*8nOCXlVk쭢-9OP +1ܹyf`4|lƥ&p#SnЦr˫ZQjL 8my=0r=xǫ{Mg0wR67ՈF x1ipT?mYǖ9wϣs :" +1/y~o0k=[o˿A_Z"-~Z+ob1??AV4:'ʷԽcfDs#l|sZ#3 F;zB'RIȬf}F0HsmNLG4x `s-?KZ"1 RnZV|{y#%Aes F$DeNXn|rצ>`=Ip~,f>f| ӈ^4ӔDDLn@S3qx1]mlwDM2fv%/S++dM#? ` Hd授D[31e u;yVV&6dd-YծqֈwEӈ0 sxmnX&&d-1LW|$uz"ahuDMVwR&!1q>DBo1u1і#e3M ħDc 0d`'d#u R @$ !8FNpR1 13*, YT06MR%brrd`AzJo^jKk;5Y~eO>v{oLڝ<g}]kgOy5bc-|=M:^6K5F[}9z>r4j32|Z%1/5kJWU⭼LcjݚJHӖX%R:{,B"Z),4a@ Ȗ3ٟ{"oeBsw029>e^LK#VzUx2VY"әKws,]y-zQYZ6-z]G^R[:3R38_OO1b=xQsn1w0#J֞e}-8{CGr{bnn7XB4tf[C9ws*Kٻo0jՉutAfCgJ>qZus4s@p8+=3Ԯ Ea֙# ͳ?CWV6ӮZZYLJLRLњ"f=pd X',`暬؋J>cž[F dd0J~S-mtV'<_l}SO' 6dZDWN]1F5;Wx{u6+u;3J18DNvNBU8 H0@((%t@Q^P(aIv&C2%G"BNed: # d`"zTdLA8.H,Z$QhIP˸!$(s N@(d 00c3#d:!:N 6'&p (.! ddw@2v2r<,A AØ0C*Xq 20 HAC@ y@#rpPgd@bQrp 鿪s/:M;ڰ)v|b']|f{px7^od7&{tOޱF\ #NOƈfC ڵ-*{go rU;vM3eƭ:N}םcm,c0ߦ)pzaVp!hiŧ+j_??Z 汙!lZ6mZV=UŹW:|/# 3eE"ڞدn=z7ԊRk-ՙ-7Jׯ->N+NYU@SKv)8jZ)@n1kFjSqWǧl_^v;ۛ 0r1+iNEvbH}1rEU[ю5y3,q91jrizeֵkNͥLOMtzI= R5[c8lq壄י=~R M@ؿ0M ͷ31+Yi5ɛLyh<#Nz+zC^s@-9VxHd&k~=Ւ5Zb:|=2FF u-|BgѷP@Xz%g Rg։s7ӭSZzR՞ѕ9ұ#8dXfլfaxz&hL+lLFVz#1i+iGZ'=Ow??Zjd[yvR9M&Y0 ]K3_#h} fڸ d 前ff#09–2uV'fǒb0@+ Xϡ520 3TԬV%3 c w13vDX'b2G\Ǚ%mnG?"`P %E-Jc`[*DahQ1 bd1+` O*F@<N a8XPF;($0 c  wBHp S1-ڲ޽+G9s)TbV|~W)ϧu8^#՚&&F޳+iN#򾟘G༳vuG6o9Ʊg-3|O=i:yw8˷tt(clwo:8hnǩwft$YЗm {p6ype'j}~34͞Cڎ(xA/|iaQD烧gu\jype|<2%|;/ұ׶K]Ktחw|ۃ)˃ m(ÞԒ<>%KŜ^ 2e2G 8i2xdrUƾQ2h ṟIDtzJ!2(Vޗ 0i>zB ˆj>jD#w m[FM&eidE?S=/Z^dh6fmhp߳bڵb^r!jqzѴ#^݁quٯ]nyto8fӌRotDKູ]!pX+M[GL@fol?T"4Iy[@յ9oifJRch2E"6d SN+Tvd 5`3Z"/(6AB6݇sڬiʼ`֙;s-{Dk׼lg$xco-5jS6[fGs юYhar僆my⸿{iwqxp<$i2g7ͪS {g>1[ow]iM,疱WãfFARUpe&X( $A * E, A# !"Y,FA0!d&2AYF dA0` 2@ ,!id 0G8HBL;B*G @y@ `d#rv1$D'02N`Ȑ;DH  &P i@JE <%ќJ# $1K$ v.  G9 (B H2`d d`2 ,0@#1 %Y`Pd >ࡀ vY7ynSSeiN3bk^6nd^,}rj}jDNc}q=>GJu+n҇74­S4s |ߡxצ"qz{EmW刞iUVoTP'iDW1miz|Cc3oܽm2hr0ŧ?? ,c/?/8jVjԼtq[g9mXkI^:@8y$b[hCBg9Nw:PoW=^ 3^ܓՎ&Q͖HbDo ~i7*`+ٚkncB&!D[W3Ѵ+,tC'@"|m11.;f_` Xtե#6I?s=0G0eHaKDg8a:vD1iRbpKoo+RbzӤF{5#C}ubZg~ҳϨ5M:DFߝKH DM3kLYG3P 13<3޽#Y#X1\_l-%_wO35U3z"L7dZ%'dg W1Ԛz4D(Wٛbgp,bp/Dh`m"fb3jVM2F&fz-?JGDǩ͘&";#1#9\0DLv"&'9PR4"173j` $"I؄'1`BӘ.O@ DL@ @ NP $:d`a.uLKN|[ՌGOҊH%YZ6FٹZZ5bxZ~R\r7Э;ԝ9O|7zjv'93Wmj۝Eq3jTVsg<>Z} ]L1ͱ^{Y&R];LXL1ҝ{gH!]l6͙"`]oϛet`qS׌N^8pxYV5Xm3B_A Ѳ,.Prq FB-+Ezd)M{8qִέĻ-:p.k>Ek\ݖՅRY6j)eW;^"Xs\^7bnzyYND9]ipq?f#sB 64kџf1 !B+p@ULن@7:,"^c;Ndԟ!M9Nӌm= "[)K稥+>h̲kjLDGy3YԊG)Ӓ^]i=lpusOuozC`_4I NSe%g\M8vI/AdQ 2  %$2@(  @ @Z FQJB``桒EY#"J܈@,(%G`(@eip%;H$R2% 0''HH$Sa=r b!$$F`2Hy -'DP@@TpZ@&a& IO @%"PVL-8d(X3 Ǫ?Mf7@K"#*@  *p @f F  @ Ӏ@ p@ BPW,{;V=n_qȼ5j1D]sM;itw`^u\{5u'+]#ioX5);td`W"v9t;ÌԽb\7h>, ;b7WJbwq[cW ^)U5uarֽb"ܑH_ #Db ڦ0ԝ?ޟ[nc1l"ЛL=uQ q]xjE,j_ZEg8H2Rqo>}H#h)ޢLNb3?J[5 5z|ZcKsۤDoDSsJ l??RqM1@tcՂ4Oj>DҳVţ,NgGřݓڌ=ݨޒ/⸎fB%emmN38 Vci44"2Ӽ2Zm(䘅sf`ۤ2icҶԆ miy'خgh20 9":3E#M߫RՏ( g46sڗ+'',oѣ>{yy?w#eO& bm6i:|-13wx Y1]w~"'n+~E==Li7uB}G>ַ{ϓ?[ekNӬO^_(۹1;%y6l68[/5_z} R-?~+#1Y1(3N:"i&-1|)8wwZ9ـ Q|Yϫ_N>sDc;}?<3^o^>}KJ:?o-+i|}Q}صkkv~exOYi?W/Zgkg??D`VlZ->hm 1΍eON1~o`)13YY#G@F|cъo[+e""1ߺbՈSV%8~~-1QY}?>kֱ`tJV:Bv4Ӵuhf6"#鶥Z'k赢bZry'@Y"aglNQ`7֌AFgd`VIVXx\[~֜5?&FF㵣10_?Ou%r]_WoIIY˞hыb:9f'0c݂֘D&SxONwY 07RӘُaG*:290nm_+VyOo6:ц^p!iEJWS-642է]GFA[NZBD%24m]+D1g [ޕٖ%莿[VX}}Xk-8r8J8\*)0;,x{X,ޙbnB{pWn{יTN]=>o s磏a~/O#VA#ՏxwGFk`mKZqiy^RpFӷu)8ḙ46>u]lm;w7J'BfwַGW?CCn;8FvgpAջzO[g^ћN|bfޝ-i:> -~#h >cK#nrtd#G2R884<l*ϫKN׭-3 &rӼ;2'BjE:u/[iUMf<}Ii?B֚F؟_isg̦b+#zbs~iN1oYhSID=cR#fۍh76*Ҿy/[LDD`L1N'Vu5"6"S3B֘>X,OZ׈??`hm&vcEghfA}#>Kf&3??znrc Vq>NaSLsLsN{#1$XM&;O/Z33 bec32 w[*EOydkحo8 1lAZ۬#bFywW`Z2-b: Q_3#@͡4F@Lge-[-z` bp2F@ SnebN'XN"J=bD¼ r a(SN3H2&QLL8"71Q FV"@)L! R ` xr P%[JZH &Z Ht DaeleU>/Blm\a5\<<#4ԞzFc=]5ǂۃgRYrr,=S|W|t[Ym^ޞd;! :-3HZ%aX,Hޠ\K&f;}[7UCoO;͚;8Z<AjZvWk@9/Vf%k]-Q fRʶ9W卽NGP^# "[>Mۖ?_G(e[vq:{puB ֆ,~cӆ_=uF0qK:rҚOIy G>SsO/*/DJ؉t߆{EjN XZLO}Om3>is -7w|0F3IP3R،¼WEmDE̵ M:1u{LѷzFl'oځshӞZO׏?[C(M80%iU!&Q0Fr ;`HY07 `X@TdP  @Y@N2J]Q)Q@/R% Ȁ!8 X'QP2"!(Hp#PH$$@d$0Uc  ((0 dJ Ā #8I`KL$P IO(%A)`!ػr'!8%.J@0 # 9#%iZY,,FAQY)F@N  VazzAݎՌo?K{ROO^Rf3ʗcNff?msKxHm?`Pd#Z)4<ڙ,J-c~02 өNiUqtEinjy Ɵ,?r3'sf]nY&3e|OF-$[~M*D{ޓ8=??rcG'Z@'s,#ebod&kz̭XiM}D–ci^q2Vf֢+k7k39`/B3f#bm6qmV->y6~-ˈ+͔1id`d;uS9&sd~\/CY1AcNc;of5 Cv ٞ\*8z'v^y-,:<^-IxQj9=:כ=~E#ɡe+ZDx'iX|FimoڊZgz&7ϫ>;NX39 ۹7S[13i*ǩ41XcaxCVӝb">};ĵfލR: +Ce5F % ֌ n:4z\ iq5͚D78ܹ@`#;ճrEg?_ Ʀ'NLL|GIpN63~s9ϩ:mJ+퟿ZDG̭Z6oץ׿G%6;>+1,j3  qϛ$f{+1ep@2u^pL:qEx3V 7`Jqy2Ě3 Vsd+3|d kնXfY눕戒bfsD&'$`dDFV@@ $&ަdBJXD%A,B&E8@JS BЦ#+2eZXʙQ-^UpL!0wAve@P|ou+nۼ,ƍ}/ur.௮zΑحiZ8w^1=~%-_8e=i{noٞ/u1xvp\JHkJj l͓ը2cG j{؛fM8RޕUo`nkdn w^Q(gЦei MLÔѦ!F̲5uWmhS ;VfǺpZyTK-5"iiԜGFޝz/ QlKkOW.?0fdjCjD!T;*ga{S_t}u6}5ciˮcR'? sbWZ[k9Ԭ`dԶdLS{= 8qh|wOqW>4cVkҝ^8x8w|O i^DսvfӜsOy:5ᄧ]gLxyKn;g(s\?2j.a'-?V^e<󶯲~)lrJ?o~"ggxQ9态\Iq8 (`M-WV1ЌynWOG͹^&G2ɩ_,S`Tճ jdLIc-'19kN{Ԭs6RDDp}>yeⵯykҶ'0GJ}}TxvKF׍~_w:FxXo?Z>~mOO^xhԚ|} {ɼD}}m;tdEg~E-=g/dџ_}F_DLZӍ~@-IKRfw>|:FдڵFԬoO/"?9Zt74D+1i1ֈ>~93 ƤW E4+NbWϠ!nlNE!h2lIcH# [Ϫ"":ՙ$W109c$mh tMcbb&9b&fHm ּcщ>.?kLyW mlQd`fscy429~MZ6Lfbw Lg[b%1332 Xꈉ͐`}¼ٞ<+&m$b&9"|׉0b9ΦwL[ 7Gr',D%90'c`H%1Bp b1$UVaĦ H@ %@@BU (@I28F 0S# Սz,`e2eI@I Bv=:p^qn3yT_[ׯ-i?sxo<4kaVѽgU9O47%XGq^1zL}OKC\Z1sݿ*nmY[^qydv^=x>| fw}9u_Ujdt{GC.Ïw1?6dsn叫V^wSSR|7X춾 "3aŜl1 qi-o ׈Ĵõbr ͼRM(5ͥ2XK\XZӆ/sܶD:;59ҶV4o1.r⡩mB#Fяa [X_ Fr PH@& ; Hq: d -  =SBb FN@̢2 2OTNԂN$d' Z $< \NL$fYHY0< ! iHw4`!(P2`F@2c  06q뭑yi ߠۏ8G)I=#.FYEՁ5̯jړ)&)B41>j[W*S9OoCO3h_;-N_^c)GUi8۹yy (ހ)i66Fsbd'N'YߗRy`dn=]+8-m0kLXy)ʶz<4ZN6F&+*Vr:3rJm- ,!& cՉkNcxlmV1APEffz7(צةzE~58bĸiTc3fiꦮV3?FRR+3Zt-ڭfclOϫGXg0 S9Cͳh#>]23m:}>} &?0bt:ӾwE_]>{W8Zj,:K4hMZԀW1847XЊkg.F+m/ycoܔш&~φL+[J+75"/ӧIKۦk??hZD?Rk6DcO{X~'lOS(G]~:1kkm0D|[F?BX"@[|]iZ7bݓ /4+bWϘ&&"'|I0enJg,QO|cЀ0MisjF1Šf0,W22/zn1-L fѝL&;"+6<"cHr+9GNy" yį-\Ϩ֯,)^h6? LܓMkLgzZ剌"&&S$ =Qˎ$G@.T[ؙ u_5Ԙu8`Z11c'( O@ DDAA0[+ @*Z#N21 d`dVeiR@IH$2;&*! ]!@6F;u2BbvB0t  2HA‡zHAGP&N2t W2t N I`zKF [<=xa %aKCJ߹jҎpJJt)[7׶s[S,x?:4Z73_wX4Xuݵ8|M= !*ǭ3š `KVmKNG+5 `gRkl^3m+^-9#ϥ-9٩Xm0@P @!6!~^XTʂԉmUF@iq6nOGi"%9g1`%m>x_3#(ҊF1`Ս66՜f &A/cg"< `r0Nwߕoykϫ%5iXVJ~}A@)I;Ybzf8L,?>}3Lajs?7̭j3\0ܬ:4&{P'ab18uF>f&Wu9cHh'8)3^Xky &)a3W3dyӪg&r@﹩lw#+z@Rb|fH#&@Դd3渃혐`EӴbL"ռcj`-1IIld[0tXnF+gkZkH[ZK-fՈXRŠ 'Y;Lg2Fۘ(NIGDfh0qї@B0""NQx`.%S1FϚ2Z:T DF+3( ܀R@$FJPT%IU( WtF(XY+$eN ][F"H a; =D% e=D"H-8!ЎbD&EPL9 (J!((` &e F:(RB2#HPe[f:nD̓F2F22\Jwli=:^+'=->7Zf:w10Z>{ԝJFכ;WO~z=)Ԙ]LEg3-Kjtmx5.ӝؚ|ۺ^хWMMgSiF3;?4slL:'%/f|uucZ]ko1}MKxn.osUU7̸2q|.oxkľn)^'垸𽩮ji}6Vk8 `+-@v (0AApF8!"Lpd:)2!Nr  0(HGP TS*/PX* PHJ@@,D3 !dA tH!`( H6%l ectw,`@,! FG8)0F"@@ ]D0R0@d$0P 0GHBYܸMm]s8|-9'joz;K(Dm!jhVQngΣƜ|U4gxOJSxiSR&㺞_Z[xYVPӮw98miq![=)7Ub1nvr43;cvY3Wno,~DreW??NzXlDVԌ-JUJfmLLC&<+&jN 3*^&5'n@c76z0Na5l}ugNbZq6P(D@ F[ic8F@˦ T,tSVܵϭY.wa2.c(=gi-H/e5׎Tڹ;o),8 _F%R3-u:DaZu+ `ų3?a8C[Nd[t(y+6|DN>~Zgl|1Nmgў-KM{Ϣ6b'/~~1R)6=ay 圭 ã}\e{K3f{sN*o.+Z{oʎR%-xojseztr?+hyq;ǃI1Q*˝/_iέ_im/gR=^Ntzمpv4oyzDN~xW֞!R۲rDw5XbJ?WRu.4k;.yjWe[F䴴V*iͭ9剅^^˹9o_Kܞk[Ow|1I}G4糌MUB|.Bz% 0 !d`v-TN@JJ%/@ DtLL0CHPH;J`'&F@ @*eB`(@Pv 0 0 T +vBE0'~dy$ 6OaD2BPH J(Ȥ9r/䄠`  2t ȩH@ pd8@d d$0G@ vP@R E޽vo-s L&%K^ 9'Xg,[iDiye)jcyѩIXu+z)E hf7Nbfw՘ӴovV,>Ѯ)XoF=+E#h1Zkw|4zҌDOǡy/}I$,4[3MYՈԞ?Z|Dgp'@ )I&tcV?!fڕ#kZ'9^~Rv@#&-=>/1 Ebk3\ۯE+3 +?s$⛖gY>~ ;m3HOvLALL}p2V˿ͩgϙ6GE?o bYmK^wWJu_y#~LF'8#6slEq`ӢiUF: ^b<ԙM_1XV杓nFzi0hn}d1&ɵst({z IZS8`H|oy# :1W#h̢&3^#)`}+ua1 1+@p Y( @ʙPX21"ici J # D јc 3F7NQ9A ^%,Ę1H31/h  Bre $J@J0Q)=r$%PF"&pD'"7ss '(3* FQ' ]EV8ZcWS?c⎎H昝&3}?u6{u|uV:;Fu%"~fbpSn_vfq|C0I":{o6uGWhM2?cC:0 Wz_G8HHN1۩KW8kg.o:}{f[S\FsZ&hCcЗ1?S_ї)J`.MBH1Zs:kOHt(tǵ^wTEYM>֞珟7|7z_SNcV>5r ;Vc}l_V5431lJ6kjZji̜='~ -)gfѮ&b|yz4l&g/iFXͪŢ3ڬCoK JeSdJ@bX9f%&61L4Jm=pgoFz5kmRv*°#K lʯr`"#20 h瞑E`[Rfzo&4 ;Rq?Zm9jV]02OVM-3&wϙ169kYODMgb|d ӥ+VcJ̲MhKZ9`Әm"~ #sV?4MXz"?BܱX*ӬO3"< ԊퟟhKVo,ijD̲ic>~Ԭg?A珙^3*ך3Rc=՘SiOǧYvDbzN>}Y"g F2VcqlLYZ5yzڵyr1Ve{V'2GH^ib>ă#b"6MdO֮،"!hN9a -KFVcm̀ߡ6' `)cuUc0h@l&"@+rLjE`mf1hЎHv"k3fV#3g22\Dx-YO*`bV G*9c+"(,:# DfF BAS%2%YUi U ddd:@DS8VrB"rg Jbptiɂ?jOE~kxMzظ7f v&+ gN.}㸍98ϝ- skY[^o}d=al>? ҜҿV\~uӏLMoM;+t"{b]#KN|Lis7诈ly_g73rDpKṣnND҈%=XVXBf9==5ߣsGJۥunr-K'gu K hWVq~rG&rާoW:84(ܒ?mXq⵵L-zwΩzۦ礒'3qN`xh4-KwXΝ<|/`LA( Bcs y # ,RT@BH$ I@ e"cP! Y(;K8 $$ v@ dc"K@I#  $v&Xt{( ҈NHJ{Na;2#"hX-!H*/RvLHB2uH\Ø#X!   $$ "p C$B$;@dw  %a  # @,@?srOSTykvj<Sk۫)y}gSOheV|tM~s}kuzA pb|{WN;OլF1ntẒIЮBF4h]{seӭ#Nb"q0i5#xJ=Zg2:Bյjrدǭ◎͝:ZcѴN>jLтtLN~dc~a3y"Ӊ~~ZҳLfgbqb31;A&"c;cՊmY#fgI-;cNcɖg"s1qnϪ=zt^bf<f d1?lZq\Z [%[#hu^mӍ֋WEGo^?J-38sg2pd۷ϒ+3jPd`f:KMz>(@1sGT|I`b2F@[LZ-)1@2OZJ´m LA NԬsQ/(L$0bK1 r+"pLd+=p˜-&@Z%iR6#2YmO$2U2zAz LX0Aq2Uќ -#%  2! dfVJ&P #tA$FrN%='pDF Bp)VH@P,r،0GDL H81<@@#)$dD:% J&Q  B`akɼܳMmm=M8u^UP,[uWbţ/>¯Ζν?bwUp{3/#ruٛf 6?mhO6;x~&[ǵs&kVX[Оh_'fDn3u39`6WKF֝ 1е\75,(ҳH9} F"Z0ѭ`m#w}5LНmZRm=!f׵^$d' 2FLFF B62Fn܃ @; J @a2:w(@H%$`id00`H$ @Fd&!(H@tR< F7I( @#t꜇r2-0A!%'Cp ;BIyG NȢ! ҝD:B#tx PHR#H2 g%e 0 H@ (`K8<$ L$F#[K,(jѪU /C[{w]חfoy[lC^]z>ObyG1JCԤNrRQnD7]ݥkS䢼<д퐵\bsio?:TG4 igдg&2jisDD%zkMi1簤}i`3[=>~F戉?RͿp@n-3 4iif҈H?7o5u9Xj)j֛8:t,tmRaX[ZqP EIZ@mzf z~#*[=-\c Z/'NG]1A,ҳ*Ek>s&khvb³ϡM+M/u t&[Z-ni&-j^>X<f3l7~>No\uZkDuY`3hW|i^Q lB2u-d f%LL|Lbq2F@GULt痿V-=a\-;NS4fAWR-N&wO-b j VӍ?Bm9|2N2Dg13'n+ZNw^g3䘽-?@gsVaYO DVbZ{ Ǒ~FF@MbF{GϪb=d Z"M󲘺ўq8I3VfkY$@ə؉Dndd NV`/+ g$ՙI,Ǒ@-be\a19 /!'#2sg̀%391 XJHgqH X(3!$BA D2@J76d@(eiO@;J)!bQ!V`F@ 7N `(3HFDNS03LPf H2Uy/NY'.LN׿{Z^kxӜsuVWQnۻ2])np>f8Ii"ZZ|?ZM?zVf.^b_t{!4g!n;6gjW 8# oڼ5wʿv sc.J<8qR#nW:#>¾Qlѻ3o%iڹOӯ5ϛ_+ss+xL; NJm8s<ֹj}6sq5tG]yz~ +aziavמlmkRssKrj~o蛛^V^pWux9/@(JQr0dI@c)셣d`FSe TL,FE(J2$@q#@>蝥0 J 5PAhIt.3 R&D$rHI@DD  8B@#)舄# 3p;'p(c` Ob(Y BO2I;;0P #82,dK`o9`  # @JC) @q  @HXp 2P @Z@dC  Sdp%E+>_;79v(t<i_9Zsq}s}dP׫^]6#Ǜnua+6gҦo1(ӢVkS(7wZ3BX~ƞm\y|9 RXO(EՒE1yr=*tf=:W1=|4Ii9QPkjEoEfcܱ6e1>~¤t5+[~3>DbrDl@U5vz[;$B J=č~"Vs9gђ-GYS912RwlӣZmDK,R`0 ԿDĢF g*vM3oé8g޵1P`Y7Vy#nY| ؙNLb9Վi Lx7UoD޳??LjG$&N̂1i|b'*Z5)@yʖҜuL|~G](_8XIͺ<=f6@LғnVIǟ҈HǗϪԴL#=>+4WbiVX@ܽa\ho3C 3icųniZb&A>h]-Y'iĘ3M9Ru&m_1iwa'??niL3M&QZM~Zfgڵ-id97tuƤYlm;1[36Q#8( MnZc\ uG0df3$KU=eY[9gFaYDDLNj EffZgc50D;BfJffe&"\300[$H+˾Iħ=Hbeht3DJ2d )r`! H#Re@&Pf@@OF)dl&   @ ;8IQF6 $@ Lt;!(OpF!9&L"2d{lA&@u0!=Q J'$"1 !l739L%! L@DI   (Y~M/{gN//,mկ8l{_h)$ۭb+xm|ڼ}4rîh!'/Y&YJͩm S8kƝ4_6{F8w VoS4xX:w&xLJ\YYFV;^7k[8nKxak6N+ w#&Lk|cGw16|6'#w_׺^L-.ާ ۚZ374yMc՚^" qὥ\WlWCz6tx+͑׻{SO0Zq{m8K[6G4g^Wpfk|9fn/KLĸ];{u=^/_/lYZ73JQ 'Ĝ(-0dv3HR J 0`I ` ɉ0Dd ALI9q$DU,'a؎ VEz`@(0 D`V$@@@$yPBLad!80I#ȥ(J{Lh# ( A@U`Hg$$ e ! FbV(ԉ#. "Hwz:] ꄐ" %(IAPH2@Ę,@`0@ %2 % >FHa (``*d9@Ȁ`@ ,`mcύm>g{:}[CgOϔ8{'3}Kgi[Mvzէ`vg6'N_Vb2ܦaVN%U8@irS[r=u"b#3۵DϧTs K=DҔ3N}?Z4) Oʷյztú9Q`#V)>~]+Di=`ԈY~jY:}3)G~@.=cۤwib'ٵ]H8U貵Q+x%=L1Z"%DccZ1; M)nT V`,֝L +KǼBfT0@Ԍ[m\m\ [Ӫь&k;VvBKE>2F ^#hR4zo8"J9YUKo;O,fXQ( {|[FkvӿI55bx! ^9oc??j&^VcyyG'tPV)s=|LJ&b'ϔZ,H?> N>ҵ49ڭ#z|8 2FS.1rf1'W o9Db'o#&sY<6>R*״KsOTw9o g{Gˡ֓K?>']+?kݜT5ߚ5z_Z x+:^|a_ح>gmG_wm-;wWiC.Zֽ3>LRs.ħ:Q^i/[R㧭 ~P/_T3.Jo$ $}h|6#]ʭ\].R;V=׈bVb?ngq|g5߸Mߴu=M"'gr ÖpZsU8je|W⸏Զwx<-O'៳MVhNxu|Wfp՜0G>~V67rݘ@'[ZZ8r|.3{NS luv{ag nVk,(JZ)H1@y# FWe!+0,`Ũ IBdAң8 D $@F P$v$ !` 0#%'26B@2I#; !?A(! ɰt: Ĥ3A"b2d!(w:("7*00];$x#@7D=AMB$ ]$" Bpcd4'f7d4d2 8F BuP3FS@}ded0A L 2g I5nc .uN>>٭;{Z'u&}ZF7vFUE__EmX9,pǟw!]]6vqϯ-׼g%V_OONk>~խHOl#}Kڳ;"1"0F>~kɜYDDbmͧmW E(Ijj"qiծkDf@&:0i@1 GUUfi1n}yݳ v'b&јj_Oɸé 5-^Ug0z`\a;Ericp ll sMghZLL-#JgՖnhcy z 9cc^; +?g{)yLJmYN昈R lEbӘ=;F~}kǔ|vG,hX)LYOfl?O|RYIĘ~ܑGoɛ{e~M3vz_Ԝ/ļBٽ]#qڜfyˍյٯ_y=g̓=h&b-2ܿ VTy]nVkcW^ؒX.NM+~1.wxj7ȩuǗ=|NL.7W0"Xt9V'6#,}{2m%pvr\{mezP:zˇ%:q᧴6=ŧ[^wyִuz@=pK_O2oi4'Nn-\R0j4y,i:`, 8 .A y $t:#D *2@(P)@Hd"d`g2 TH0`d N  LC`dnlZ0Ve(DH&$7X9A.QLPH#L# Hz 00yp`y>(Vcy!L`S$0d`!(D #IB*"`@! 0G: ! @  (`+yǯur}[IW1j~w˳<KVb=YGksֆ'zQ\tgW+;>՛='Izo=zr@lG;٤Z1}m Xqˏ6E"yz9nӡ5b~~昉zjZlh]N{o9TZglO)Y~IZC}-sf~Ϙf*JOgM )lӤĵh;z})mW3 be:H$C5:4vјjZ&[֦# !j]HX%q5u2Zv-`#N3ltA JV`ښqizCVϡ `NXV+o5ʓd)LM#SܾBAӞ^;uO.dLIb>~D%̍&tbX.^ս:z޽#ȺH:hڛ.kDg??SRgEn?q cIפV|d{F?c0ԍHUz֑\d _;_`1G4Esخ)ɟO[gښgԁ/쉚ߑc"TbY];R"yiusz=D>Z֑,|ڑ!g-"Da[Z2gpd='yDbщɜ+ DDt_g|Ͷ[~y-1uf1FF 6F+o0o@ܕV̦m+Z#39b:2JD-`B9 +uNfLLLFuBz"-DH@!h"!1[:09d`dHP  "fL`bVF Mz"@ࠄ%Kيg'J2~i 6&c %1F#A J  D$r`!* `2Bz"#P #8sQ17LDST;&a8 D=I J+c3dGD$l#)p` $l!#$ m28L:?y% 6x6)Rztt.If/S0n+*};.:qVK9GFWxPe?xr7fC4}1Cv#r08+>ϼUn]AYGi"Ec=o_f4b7>N16o`jy.煬$8}xO W ir{lվ8j̠^5#jc![6FZoTf՛{l1mp hgq ѷzwbkʭ:rN nSҴDm^Զ3|H:b77u7ԧ\COt:~ѿ6'i6}KGf W*+r![N"wJԈcl咶+Io9H2ҕf#џ#kjD|+֕7Aؘ|b#mq~1&F@ԈvZeJۛ$Dbea2)% #az6P(4^,)XWD#c Vq:_ZrFfXt3xyW׻4$c08ֹa?[r՜cI0i1ՎlDJ8bhg TT=D\G_3GTR"6zy&O͠qjkV?1ZФJ+3LXzr 3;AJiy3S58FA`lR18#2SO1hNZ:`xH)52ɈErLI` Ģ5#8y39A fәȬtӥNIP Lͫ^ kKVտX1HY~/7>}Wů3z0 Μ8df:+iܿ5^)cN&c SS[97Lhb0ˎ-|;f9w#s+fzsFcFF Lj12q=gll@+8[1;Ϣ-ۤDL' sVf%3b#!3* H3 c92DDs Ȏl""@ bps+b0`Z!l @BYL BJtD*,D31 )Ecb" 𴣠 XEs Y:$t#qDJ@Aܑf&S` 1 De@ bMctDcBsbg)F)d&q ['#c2'LL% A 0 J;$B -*ɀ ^-LYIꘜ-lL" Ș,uy/>=$of G_{a˯m:x,|,7v9gFOˆ'Y\u-^&Z:hs:|"{ q;ZOk^M澗W=ZΧ7 YiD|/Y~YEW̳W_]OďaEP L)d`Bt (C }0`;# .`bL!'!A Gw $07pGH @nvOtv&%$@20I0'0E L'/BA@  '@ dJ-g`LD'&P+Adb *'&_hpcy(u<, >,@ !H!(0F @-@c$;<A <N 02;˚6z]έ˧j7aͯXvLDcqu˵Z,r }zzoNGF\9g}SYDg7'),wTnwn"cZ򯢔clӽg=~}#9ҳ5y9krֱXX j҈6"f31?[,O,;| --y7?S<^ @۬De6Z7SoWm2XmDE:|A jDCW??l#jF|,|;y2V63xaⅳ`>JŹbei6!<`V7-bfq[|3Z'jsF9[fH6E3ӧϠ# c|ƜϗϢmi6&za33?h@yyLLYhY9S182fI>ך-^-GYֽUGG7.EfAyN<S35eh@Ԍw#;-h jn,82BՐ`IJ g E'+[dLLĭcf#əNbF.c+tH Hd3 Rbd@B78vFɃAlIA@"EBI: d#HVS # #d6F`INpQOu!(%Qa3# J"{%3q1w1ԃi(B}B 1ؘGR=LB'0 ainm8NL&#L DI"3 ei&@JUiF9  HKNDdiq\:ˮbX2?ecFj'>m?LaYV65Z:[0h}W=q֊\4SR/r Wu!0$ @@; # `; !P%!䌀 P#@:$2V2H#A(P8! @Pfcyw20)cDg):p:LD"HF FSLFH $`Qi B{%@NQ  iQ@*2$& p F2N22C $S1%`0DvI',ɕf' DK  ,ɐ 8 0@  SH E 20#`222<2 kx\zܷ=1=Z&X/=^n.>j]=(=Лͱv~vګ^RJhU[isZ#ϔ9׶e5ȭltW9aX-+jk[|45fs=K"o=c?wmEf6ZtZ;GK 2X>~lVOnX`ְs/JE8:YOB6%#َ4^̕Ӌv m:[DU *`-UVQ WTRw# %If\չ hqՌC6Oxj-3޵&inJц5GR2ewմѱx}Zln}0ZԎ?ZLLqމӎCi/_VĶ[W}o,c)MYzBk[Dv"mZ'dDY*^g1*{Lg31>KZtlo1$WOH?+& iga3:S1<ٔpF@xF^f6c%&2ϧh)[Ouc&C#ywaIԈ]0F qD&յfvMQmd_%힄&;zQfGGZ#(^£tBL:S,de 20B@;kV?/TӦf~~4kdxj| 8ʷ埡Xs0e0yʱ6ٖ74L/;baxT^)\@y&Йff sc0tLI0MavcsG[Z�w!i٩XO`w"6/ڬ3&@6fSaN̸؁(exF#k)hB0ijiL`H.BbpzEg3r Nxc8bxϛjퟹ=sZV%Mj?VߡZRGL|3Rg3v3u =Q^N>~&Zwӽb~~~mgVAp 9cmWc="cZv(tfcTѦ&q9Jibs$dzxd䈌bg=L-^1nbҘ@'tcłۢيHǧdM"4ОffvfV#8E[;bOE3/ז&{15yLp7?D^2hlf:/+J9=͵fGuf'ͬ[.8Z2ʌ:(+LFH;#,,ddHd#VdrP `*.=Q H9:JNDtJ@#"'H8,HpB0A8IF BJҐ& Bp,c D'; # ,DZ! a*VY"` F@D H,J"!w@Y0HNFSA @ ;GZe@`2 2$@ L@  #_&}a.zV3hYt"gVKSW6}Vg7>zC]> N p(~IuC`jij>6#N/҉Naf}?F4k=rVDoC-Kߛyvيei~w9W +Lf>+kИW&eӉPӵeq[2bgg+:DJxtOXWO392]H4y19uq hdi12Ŏ !e"er $22/4YgVkfv`=ve3`'ZvS3 I7^,ڍ{3n .ujDLjVbiy N%oW~͊cbQ1R.bzO1mjDVDFN b>vYo< ZRs(X}>[~,S1Vz/nYO_R@a.{NgFⓌ[q[R?oV%OL$!$2$! P%:PH<!$c ; LSP;`u܀r$@&7;S@+2H@AF8Q,IȤ2PMEy`AOH@)`c@';duq @`@Y3O9@ L @2p!DΈ9@C.v!! B@dHPeLd#`!0Zc]^OAxG]&Kq:*pŶ0 8ڶgxӭf{vM6yGLeZճT+h[qf~q2t&)~2*5ϣN7t bbb#˻kV'3#؏%mMy|,N#1Ɲ+rO Zo&z&bSZ3fm^b{NqkscΤ+1qX Qhِe-ث68^,SS*۠# kjUaZmS90F vS,t&qE؋p Źmֈ"' Kbe2ؽbwk_J@ҷŞ͍:fbvdѶFF IC-xY9 X8'ʖQ1=ZM~ڼo8:qOSF2w1V93>. )1~VwXzl}+iN>}4ՍMT5+iקgڻכ^fs9_ܲ&"9o(\#?bg?sZhmVob-Ƶgn,oW>_a[2DʖHŀkZg,t9 ;Dz&5`[f'h^I# Z;&s??rfief-; ^:31Ӛk+ͳ`UW۩11f6ʜ x m^Sr/hlJ;Pd`c>j둑"#2ԙ,y Mqb+ ֈd DgANBR0cD@7D2DI= @Vf""- I@e0tFf %]́ hH,Dʙ=z1Z7J A`FC@)! t: J{#0Va9ɼ0U `D[e(#b cdl@sOHNe1$@H`F0$D$LZWXe tDf@ d`uU8& 0@La 2& BFI^aIl~lj6)ߛ;ܲkd㣧}ӤqsY`{}[n|r`(BCBE0RBLwb҆P  $ )CHG@'lHyL0 L &`` b.t H  !'A 32xSY:Y-̦ 2& Od#,$$ J]J{!=@(0y,v0 Lb@"~#@"S``0a0ΈJ@0TΨ$ !(1J@d<ʘwc 2H` BP@0+W.ƫ{ {]\4ES7 8罖?Q5杘Yˑ ъV;}JVپ#TЬ18T]>]8Yd9Dollk?;5+:ci1 V1ۼnhV"~lc(}ޖӟHO,rrd6晬m)m^HZ-mMEJ3ym=z[v#8ֱlzuV3&&`]iq{3\d9HEY~7cek1r[Rw2|6:Gr`QidytixiiLLӋw+Ќ3ڜD|ZSg=:35–g9Z&&F:"&gf Frou-23yeny(&m8SZl@-6c0х12[Z#|K,L2xW;l#^)Efcldd c r5=&f@ +'x&k=)\Gjwd )BSi^-LnF#3g,"bfwZ%^wV$Iؕq0@J9D" NNL"`e6NHc&FX"r#|L%GHH@@*rI8Tbnp @ 0HNc t::A ³XY3 !=@1 &;'=c|'>s)'33 Oee<L=UJ`* B :8- DuI#12 IJ2); @@ A(HltL&L &lHY{~lƪڲ$ajuCXa۾WŻgs4Nd AFA; NTJ2%2BCq(0.,t  w d`@ ad"a3Os Jd&Sd A2;z!LvHNI0eh* X"":pLɀ;r$@}ppyd AZJ $Ę!L&::H-P tTdd'rv; vZ22#<t FҀI@@SP@2BG)Ti`n[/Zmi,},>!A|g|}ߩmK^'B'mS4DᖿZF[lؽo34~ƟN?ViX7_O0[Vdx)m,L:4g+i~@$Z9T14,Bo6zC:-4t36Um>n؀0lŦazfQTG}dMb휰*I#7u-ZTK-+Xenu~0 "ktZU<2tZ;22I12#Ba`@ GV8{IF8 ^0VsejuFe6 ZsݎrW@1V) J12La=@t&Le1TPZbGEddϚ[0v=A A!(H c,$I( #J$0 JaHOP@AĘ*&{$(@OT3$So, ԯ@FEgy1P!3(% NLn~*g@#-@'؞tQ=QdLFU B`0) pYyI( @JE RmnA *td`X =1@ $ @`0cS$e{t^7#rrd|'f]5xݾ=LA%2C&0(:$*( ɢp-0 *JJLu@dGrΨӝ=Qj:H2;u#/^jS42=?"0y@0c+L eA8B P'10uGuD$` ]}8 kGKPW ;NǗҍCH&2t "܀N2W`U)v CP'S;Be5tC`10#Ubz PU0u,##QQ`ϱX@b|O endstream endobj 20 0 obj <>stream H[DѶ=9uJ $tؠ4?;ѾX`]MAz_%֟t ֟tk]oYZoKV o@ʇz S}"R} $A=䅒I9Py G<> OBzӘ\Hw2%3 OFqg@Έ: ~exR;ĤWFM?_n$/uzʎq^ӝ00 %ʎn]wtΈ<;FseD9ӕ;#&6 ƕy'M#ؼWFMpY;#&8h;#< ;m:|gDiN&8hb^G4yDG4yDG4yDG4yDG4yDG4yDG4yDG4yDM^w<鞮x #< #<閮x LgHtDMpIxtCWWq2/ <<#T$-t>ӝߪYKNW-)]Y rejlWfZqρU{ȅ|ҕYms`ҟ'Ylm|_<,pԕms`2q%veE;XJ\g_YeWPëݚ󆕍<.U3"$g锎=s`1 *ڭinW:\lρULFp'h8Ӟ__8s`1 *ڭiͰKMPnMsog{2f:3AE5͵6F1 *ڭinmP_*c#ҙtMQUnJ>ʺ^s`ƕM:U%c纲'E/9G\Is֭gE9`$|\wUNB>ʚ_{+3ü=V_}/p>iJpe?2h0pϟyeM1W݇NWT\}пqWW]2=VO4].p+j+{s`մTDi>ûM/5ksWWA߼W~eE_; b@M[{2Իo4u*KdRipԳ=VO4ι*ࠡiw4mjrXe_tjξ޷K1嘭%j8=VmBJbZM{.&Et,4ŴXjfnV^oXi1yjS"_1s*klXۑDkʫcmG3-?uq]!%ʫqȽ#C׵vjGJRT*JRT*JRT*JRIx??sr4X.ׯnZsrsogGK =KW:Bs~u>ީ^ dd+[7\YoaqFh~h7oo}r,l{ŅL>LSy lm7'WreM{0 B~!m4O;οgƂØ&ŝQvl9VYT$8N6Gmh:̠ۤ羲 c5r̚FDnSl7 2~T٤i\(Ld+۫oJO~eQ;tFۋ& ǛWWD 7N;ok)s&25,['lxqdR?[o~uՑG& S]0.4rw gg&Ǯ;x0y?eW~ge!+a1i(WD0'>qwe5≓=n|dX#9fĞ]lC '<&Ϝ 6>,(s}Ե+bwu@5_}ۇ]ga_dYՇ}dZIcf)sgm+vOA;7]UUHW ~Mo=yf$G!B=L{f$!B .n 3R UCVbMȧ 3R) \sEMH Ku)X+t'YeYeYeYeYeYeYeYeY_Ow³ endstream endobj 13 0 obj [/Indexed/DeviceCMYK 3 56 0 R] endobj 55 0 obj <>/Filter/FlateDecode/Height 567/Intent/RelativeColorimetric/Length 10729/Name/X/Subtype/Image/Type/XObject/Width 435>>stream HׇWqJP GDEQQ+ڴnE5FiqHL\+IMNǩ[IЊ D#({rpȸ|u{i!9\Q}1T;W_4jΆSyW7 w_2{znè:sLe|D]msw(.}K=xP/@1@E]̏{X۫`6!V|Yug~b}j>Wmw+rKsOmulՉ}mw/+_v=xy/Xyp_y ٫[QfVin@r*xbھ˗hcnBE5; o7tĊ΍(GFȰaUtst٠8!W Ra{ܸ)esB%ޗ.ܔ|U" qen]VXST+Hm)soH"+V5֬+&DJ-n\kuWL#uTI4vH!♯.GU' CNjRP)j^fxQߑq&'Ji /?6$zxl3 D7g8μobLHBB) CHo{X4P'2=8H)Mb;I] Ros ZIuӚDRjJu.n/ML"RB΃"MhRKʫUQ& ~q#(^w,#)EE)53xy=(5^+$&Ĵ iȅb!05@&ax܁DI΁xa8R=l. gj ҉C8S$PJKP:/te `&k0^8 #I{MD}J){2Lb $u!r1&)Ou\4HW0&Hqi&҄?V uVAIb5EBLJCyW$OI *3a5GFcy)_@)-"L&R LNT*`LR $C4$ ։hMV\r${ҍf6_fK=yEEK_esm3g+eLM_/8i茻GM9V.ڜ{Xޚk%ܼZ됿gU1%}=nPxd?6sF|Ċ>:Ts]G?._{B;oڽw[o$=:5}-̳߭ٿ q|UGƍ7z{ yjpϡ"۾װ -^%..СCmY<+Xs(z)mˌS_ =} >kΘr`mϥ'v-eٖt1p+ͭϲ3LIQoRߏW{[W[o'jno[, aʉ-*ѫSݍU@=PQ6eVYzP**c;je7*kA~GҽTI5XT C΍v\ǦeG1>ܧdnLw\"ˉ UYrK#,;8_f0l5gx1ct*R2 p(2CR3`ޮfĢ:1F0I:$ʕ TXFoJ%ݤG, 2R8d*K~?r ӐĊ҉eI;׊Ts+z%}. *KnrNuIp .ʒ>~T?I.9ET例V}.lWZSMeYnUqƩ*ZfpSvQIe)Ij*nG~8[Uq|s/!R&, XXhB1bV ;cSWHÁ|5=4K4a+  q Ay$p/wwiu}h~?_> 1y<#9&%Q|.=-$ǟ{f=f%=fUXY0o,fc[Ѳ!M{6I˵eT3^?//vT3_-d5(͖LCL+KMR}qGdT:KqbXmy_}n/KsdǗ&)߷f֡_AiXiҧ}o*,6dޗ*ä/}m:N Dx q<gs>6-{:`-2yߚ}tzf/zn>4 {eM,1K k,e,6&*}e6N]X8ޣ꼏L}nVx7ffTb}O}mVh'fgwyĤO_X)})S1R|_KYjeYEzG~pvjNLqzֽbf! <k6 $*Y?S+a|T?pdN?E1`Ci^msg]h5xh )AspTyW !_%ˤF? kI- _t8oB<6yMĉe^SxJ׏9zb7Ns+]IQq AĮ+Q󺭡?:WYjR#5 䇿T;Oxċ=HONV" 9Q)dME~z]wZCn~XrE)Ţh L_ӕ2)SWR߭6e}Ul,=e?pڤ(NumDR/%yxAC{hIQ[yE_G'p.4f'EQmvju:Ha] ߕ4?]q5hF/ .twH_d'yw 3vEm/ښ0M3V$@#yI?Y\4Pxz*ԼQ3F\*Ԥ(ztP:Ŋ`-OӖpNR.[R+H9$^FDHr"GA+z)_;A :o0uA7E)-GQ~-̈́S.j$x ˄[.Z&P oeIQp ? {c~%h>xS#1 gz8asuxГO6_H؛ |!akP~- )A8w-*_SצRE489# "zGyMxǻ7]K4 6h,a޸&c)æ{-^üN{4I^;ð)ZgCݛxy,nr;ql l{Lgyjz%l:1) v&ex~]B4g"E gWx_[taϦjEwz<_4 ]x6݌.OkCuwa8ӦM=3h?ϛf тW6G'[vfw9d5,/M[蓞\Ѯ'U?[ `1Ӧh 5k蓞hϲ(z}\d3?͵ zk*I+lצj=A׼'|\'z.|-@ n4}>υO6klI צq蓌'5% ݄>x.|k蓴a蓌*dU蓴a蓌*d }2LO2K(M @[$I2$$H2k$s1K(M @[$I2$$H2k$s1K(M @[$I2$$H2k$s1K(M @[$I2$$H2k$s1K(M @[$I2$$H2k$s1K(M @[$I2$$H2k$s1K(M @[$I2$$H2k$s1K(M @[$I2$$H2k$s1K(M @[$I2$$H2k$s1K(M @[$I2$$H2k$s1K(M @[$I2$$H2k$s1K(M @[$I2$$H2k$s1K(M @[$I2$$H2k$s1K(M @[$I2$$H2k$s1K(M @[$I2$$H2k$s1K(M @[$I2$$H2k$s1K(M @[$I2$$H2k$s1K(M @[$I2$$H2k$s1K(M @[$I2$$H2k$s1K(M @[$I2$$H2k$s1K(M @[$I2$$H2k$s1K(M @[$I2$$H2k$s11     r< 6 D R* 6tPHit/QzB1̚>#-2*MlӤQ~3Fg 'Y4orɖac鏂c74}䔈q'0c*.]3"J-^ӄ ;._FHR4SsEFPJ1teӑd7xټJT?3xG*YpL҇qin5ݠ}9C(OgT[ݳEk/22Ux1v49p~0q̺'s CY"5O(Wٜ"C*og!riBV3L#7?hK *;߳PI{AIψ(C\ӄpQ;5a/ʧn67h ]pTڋR{B.HI4,]j@% *3itV+R~F$ӄLΑh׉̀N!l qFwI=#dĕRNEGeԧ+,gN]lX9~N$ӄWs*JDp?`hB{FDi4(SA1IvNNk]` QZA2b^K)%}av^bf8T<#tds &/G!hlBO|#K3"J#HI\vL+[vt lEN /Y3"J=H IN[2(f~q=HY崹;<#d fż@'(Eψ( &, )TÛq%j3JsːL3 8 /ft;k3J`Y8z[eHA(`jXF?wXOz[y3+#0R<ߥePnqE'Nos0!'fb KwGincGcmN- zRzTvbB ˬph2?vho&-H BiPHZ r~ YQP.A2M2 z f1~OFW9ч@tI3YQP.A2M{4 &bTFw947ʊBrWh )YPW4JͱСdT.pH/V^drE!D9ɴ?g)i̗xz%*W4r- !1Hكr/u3V>ؖM:iZ ?v- %)HٯPYL/nxVwdrf[QHQA2%TP/<`ZS|Ox4]iYA|'٥((qL |0yk#v6۬ 9]\ZCLqr|4 :*rVCRA2MHD1Mlݴr?׮$' YE,}r̛gD0HY͐28u+㣡-2PE*a 2sSY`'Py4S~tp-||gNBAy[kvbQx2ubH?B[nbL?3>֭!g!gD(^L]%uw$3?b:َS$yޯ!q4ψ(apL&%ݟ1{&^e͊vb&qg}dvM<#1o ʋ8Ɏ;քu==<̸a hIt-iΫFG;%=ܠ-#Vr mFl`V`FOΟ<#DA2]eW?g9&W}ȭ,.GSN/<6%>ڤfgks&,c{D.loge|-}5m Lz㊂RhJӵI>U1bJ6JL q`T#tmbWTґ{jJ;bZ08}j}In]jC⢓`T4%/ǔrz'Pa5҇S@yJӵ s\t`v؝r3f`T2%t[;cȥimd*mIqQ0Pqt]ORfT7U2KDW43hBA'6}14@40&D1V4_b(*zf*uӧO鯝ʟ~`rFOoЊ,&ϸT:Ͼ^,?<'|_|z:6 `0 `0 `0 k n*=A-@p_ia7F,[z&"wcv\[b#s*پ~^x8Hsn"#[/]C^c$0];(l y*1Fs:P)]DXfP$3":+ELn3S4hD}frK!XU s,rPѭwxE L̪wsE"[0+a_g^Hp',FRolbmh K ᮰7 Ə 4[rrB) {F?k1$25`9V?%KR6"gB"kRG!mGE: 2xer!Ƒh(N_`rFO# 2,_g:6H=Brz; Z# cqӽqZ⫁Crcgg܈_=G!Teiϑc;{!ؘe9s[M_l UrZnp[ٌ<anCEV ;AydGF_t맅< o8-VWgGF?F8Ks0ݫ0`_`,}E֢4"G,F>Z1#@%2pA_&3!-qIY̱NdYqD/=ց']Gl~F_y{10&JO`9la ꚈϬNEtUo(F[n5ǦȺ&Vکh"3=( n?!Eޱ).n&;/2߃`cm ȉ]QS%F0D{Gn5Sxi{ST~Ad_lA @g-EHu: 늨51p7>-WN嗾B:r#TqOu4[nuIwct ^q` ׭?QZaTrnwPZ`0 `0 `0 `0 Έsө endstream endobj 56 0 obj <>stream  endstream endobj 54 0 obj <> endobj 9 0 obj <>stream ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufugu